Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser] Popgenie AspWood
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT2G34400 80 / 1e-18 Pentatricopeptide repeat (PPR-like) superfamily protein (.1) AT3G15930 71 / 3e-15 Pentatricopeptide repeat (PPR) superfamily protein (.1) AT1G31430 71 / 3e-15 Pentatricopeptide repeat (PPR-like) superfamily protein (.1) AT3G03580 68 / 2e-14 Tetratricopeptide repeat (TPR)-like superfamily protein (.1) AT1G11290 67 / 6e-14 CRR22 CHLORORESPIRATORY REDUCTION22, Pentatricopeptide repeat (PPR) superfamily protein (.1) AT2G42920 67 / 7e-14 Pentatricopeptide repeat (PPR-like) superfamily protein (.1) AT2G22410 67 / 9e-14 SLO1 SLOW GROWTH 1 (.1) AT1G74400 66 / 2e-13 Tetratricopeptide repeat (TPR)-like superfamily protein (.1) AT5G16860 66 / 2e-13 Tetratricopeptide repeat (TPR)-like superfamily protein (.1) AT3G62890 66 / 2e-13 Pentatricopeptide repeat (PPR) superfamily protein (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.001G258500 [exp] 193 / 1e-58 AT2G40720 481 / 4e-157 Tetratricopeptide repeat (TPR)-like superfamily protein (.1) Potri.017G084900 [exp] 76 / 4e-17 AT5G39680 782 / 0.0 EMBRYO DEFECTIVE 2744, Pentatricopeptide repeat (PPR) superfamily protein (.1) Potri.013G103600 [exp] 75 / 1e-16 AT1G08070 477 / 7e-160 ORGANELLE TRANSCRIPT PROCESSING 82, EMBRYO DEFECTIVE 3102, Tetratricopeptide repeat (TPR)-like superfamily protein (.1) Potri.005G202600 [exp] 74 / 3e-16 AT2G42920 660 / 0.0 Pentatricopeptide repeat (PPR-like) superfamily protein (.1) Potri.001G466066 [exp] 72 / 2e-15 AT4G33990 1067 / 0.0 embryo defective 2758, Tetratricopeptide repeat (TPR)-like superfamily protein (.1) Potri.004G059400 [exp] 71 / 3e-15 AT4G18750 1110 / 0.0 DEFECTIVELY ORGANIZED TRIBUTARIES 4, Pentatricopeptide repeat (PPR) superfamily protein (.1) Potri.002G072500 [exp] 71 / 3e-15 AT3G21470 565 / 0.0 Pentatricopeptide repeat (PPR-like) superfamily protein (.1) Potri.017G141200 [exp] 70 / 5e-15 AT5G66520 407 / 1e-135 Tetratricopeptide repeat (TPR)-like superfamily protein (.1) Potri.003G088600 [exp] 70 / 5e-15 AT1G31430 690 / 0.0 Pentatricopeptide repeat (PPR-like) superfamily protein (.1)
Flax homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10027366 [exp] 129 / 6e-36 AT2G40720 328 / 7e-101 Tetratricopeptide repeat (TPR)-like superfamily protein (.1) Lus10000020 [exp] 114 / 4e-33 AT3G56550 100 / 2e-24 Pentatricopeptide repeat (PPR) superfamily protein (.1) Lus10002552 [exp] 80 / 7e-19 AT2G22410 299 / 2e-97 SLOW GROWTH 1 (.1) Lus10039703 [exp] 74 / 2e-16 AT4G18750 394 / 6e-127 DEFECTIVELY ORGANIZED TRIBUTARIES 4, Pentatricopeptide repeat (PPR) superfamily protein (.1) Lus10025915 [exp] 71 / 5e-15 AT3G25060 627 / 0.0 Tetratricopeptide repeat (TPR)-like superfamily protein (.1) Lus10016425 [exp] 69 / 1e-14 AT2G22070 1002 / 0.0 pentatricopeptide (PPR) repeat-containing protein (.1) Lus10013341 [exp] 69 / 1e-14 AT1G05750 525 / 0.0 pigment defective 247, Tetratricopeptide repeat (TPR)-like superfamily protein (.1) Lus10031423 [exp] 69 / 2e-14 AT5G66520 538 / 0.0 Tetratricopeptide repeat (TPR)-like superfamily protein (.1) Lus10038400 [exp] 68 / 3e-14 AT3G57430 1097 / 0.0 ORGANELLE TRANSCRIPT PROCESSING 84, Tetratricopeptide repeat (TPR)-like superfamily protein (.1) Lus10004987 [exp] 68 / 3e-14 AT3G46790 715 / 0.0 CHLORORESPIRATORY REDUCTION 2, Tetratricopeptide repeat (TPR)-like superfamily protein (.1)
PFAM info
Representative CDS sequence Show only first row Show all	>Potri.009G053566.1 pacid=42772276 polypeptide=Potri.009G053566.1.p locus=Potri.009G053566 ID=Potri.009G053566.1.v4.1 annot-version=v4.1 ATGTATGATGAGATTCGGAGTTCAGTATTAGCACGCAAGTTATTTGATATCACCACAGTTCGTGATGCTGTCTTGTGGAATTCTATGATTTGTGCATATA TTGAATATGGATTCTATGAAGCTATTGATGTTTTTAAAAGAATGCAAGAAGAAATAAGCCTGGATGAAAGAACCATCGTTGCTTTGCTGTCTTTGTGTCG AGAGTTAGATGATGGCCTGAAAAGGGGTAGAAGCTTGCATGCTCACTCGTTCAAGAGTGAAATGAGAATGGATGTTTCTGTTGAAAATGCATTTTTGAGC ATGTACACAGATCTGAATTGTGTTGAAGCTGCACAGAAGGTTTTCGGTGAGATGAGTACTGATGTAGATGTCATCTTATAA
AA sequence Show only first row Show all	>Potri.009G053566.1 pacid=42772276 polypeptide=Potri.009G053566.1.p locus=Potri.009G053566 ID=Potri.009G053566.1.v4.1 annot-version=v4.1 MYDEIRSSVLARKLFDITTVRDAVLWNSMICAYIEYGFYEAIDVFKRMQEEISLDERTIVALLSLCRELDDGLKRGRSLHAHSFKSEMRMDVSVENAFLS MYTDLNCVEAAQKVFGEMSTDVDVIL

---

DESeq2's median of ratios [POPLAR]

Mapped by: StringTie Salmon Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	NWA:WT	NWB:WT	NWA:OE-ARK2	NWB:OE-ARK2	NWA:miRNA-ARK2	NWB:miRNA-ARK2	NW 0hr	WT H20	WT-NW	TUA1dEY NW	TUA1dEY+TUB15 NW	TUA1dY+TUB9 NW	Pde NW	NWA:WT GA	NWBWT GA	TW:WT	TW:WT GA	NWA:OE-ARK2 GA	NWB:OE-ARK2 GA	TW:OE-ARK2	TW:OE-ARK2 GA	NWA:miRNA-ARK2 GA	NWB:miRNA-ARK2 GA	TW:miRNA-ARK2	TW:miRNA-ARK2 GA	TW 2hr	TW 8hr	TW 24hr	TW 48hr	TW 96hr	TW 336hr	WT ACC	35S::etr1-1 H20	35S::etr1-1 ACC	LMX5::etr1-1 H20	LMX5::etr1-1 ACC	WT-TW	TUA1dEY TW	TUA1dEY+TUB15 TW	TUA1dY+TUB9 TW	Pde TW	OW:WT	OW:WT GA	OW:OE-ARK2	OW:OE-ARK2 GA	OW:miRNA-ARK2	OW:miRNA-ARK2 GA	OW 2hr	OW 8hr	OW 24hr	OW 48hr	OW 96hr	OW 336hr	Root CTR	Root LongCold	Root LongDrougt	Root LongHeat	Root LongSalt	Root ShortCold	Root ShortDrougt	Root ShortHeat	Root ShortSalt	Ptr root	Leaf CTR	Leaf LongCold	Leaf LongDrougt	Leaf LongHeat	Leaf LongSalt	Leaf ShortCold	Leaf ShortDrougt	Leaf ShortHeat	Leaf ShortSalt	Ptr leaf	Stem CTR	Stem LongCold	Stem LongDrougt	Stem LongHeat	Stem LongSalt	Stem ShortCold	Stem ShortDrougt	Stem ShortHeat	Stem ShortSalt	Ptr shoot	Ptr xylem	Ptr phloem	Ptr fiber	Ptr vessel	Ptr fiber vessel ray
AT2G34400			Pentatricopeptide repeat (PPR-...		Potri.009G053566 [exp]	0	1
AT1G55800			Domain of unknown function (DU...		Potri.016G003133 [exp]	13.49	0.7000
AT1G12700		RPF1	RNA processing factor 1, ATP b...		Potri.005G050060 [exp]	56.12	0.5979
AT4G16160		ATOEP16-2, ATOE...	Mitochondrial import inner mem...		Potri.008G107200 [exp]	87.72	0.5762
AT3G14470			NB-ARC domain-containing disea...		Potri.009G081000 [exp]	179.58	0.5916

Compare expression of checked genes

Potri.009G053566 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.