Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser] Popgenie AspWood
Symbol	RPB13.1
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT3G52090 219 / 2e-75 NRPE11, NRPD11, NRPB11, ATRPB13.6 DNA-directed RNA polymerase, RBP11-like (.1.2) AT2G29540 54 / 2e-10 ATRPAC14, ATRPC14 RNApolymerase 14 kDa subunit (.1.2.3)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.001G246600 [exp] 52 / 1e-09 AT2G29540 136 / 6e-43 RNApolymerase 14 kDa subunit (.1.2.3)
Flax homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10019715 [exp] 176 / 4e-52 AT3G08020 726 / 0.0 PHD finger family protein (.1) Lus10016404 [exp] 175 / 4e-52 AT3G08020 569 / 0.0 PHD finger family protein (.1) Lus10016452 [exp] 54 / 3e-10 AT2G29540 131 / 9e-41 RNApolymerase 14 kDa subunit (.1.2.3) Lus10040717 [exp] 53 / 7e-10 AT2G29540 132 / 3e-41 RNApolymerase 14 kDa subunit (.1.2.3)
PFAM info	Clan ID Clan name Pfam ID Pfam name Pfam description CL0509 [poplar] [flax] RBP11-like PF13656 [poplar] [flax] RNA_pol_L_2 RNA polymerase Rpb3/Rpb11 dimerisation domain
Representative CDS sequence Show only first row Show all	>Potri.009G070900.5 pacid=42772493 polypeptide=Potri.009G070900.5.p locus=Potri.009G070900 ID=Potri.009G070900.5.v4.1 annot-version=v4.1 ATGAATGCCCCTGATCGTTATGAGCGATTCGTCGTCCCTGAAGGCACCAAAAAGGTTTCGTACGAGAGAGATACGAAAATTATCAACGCGGCGTCGTTCA CCGTAGAGAGAGAAGACCACACCATCGGCAACATTCTTCGCATGCAATTACACAGAGATGATAATGTTCTTTTTGCTGGTTACAAGCTGCCTCACCCTCT CAAGTACAAAATTATCGTTAGGATTCACACAACCAGCCAGTCATCGCCAATGCAGGCGTATAATCAGGCCATCAATGATCTAGACAAGGAACTTGACCAT CTGAAGAATGCTTTTGAGGCTGAGCTTGCAAATCGTCCAGGGCAGTACTAA
AA sequence Show only first row Show all	>Potri.009G070900.5 pacid=42772493 polypeptide=Potri.009G070900.5.p locus=Potri.009G070900 ID=Potri.009G070900.5.v4.1 annot-version=v4.1 MNAPDRYERFVVPEGTKKVSYERDTKIINAASFTVEREDHTIGNILRMQLHRDDNVLFAGYKLPHPLKYKIIVRIHTTSQSSPMQAYNQAINDLDKELDH LKNAFEAELANRPGQY

---

DESeq2's median of ratios [POPLAR]

Mapped by: StringTie Salmon Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	NWA:WT	NWB:WT	NWA:OE-ARK2	NWB:OE-ARK2	NWA:miRNA-ARK2	NWB:miRNA-ARK2	NW 0hr	WT H20	WT-NW	TUA1dEY NW	TUA1dEY+TUB15 NW	TUA1dY+TUB9 NW	Pde NW	NWA:WT GA	NWBWT GA	TW:WT	TW:WT GA	NWA:OE-ARK2 GA	NWB:OE-ARK2 GA	TW:OE-ARK2	TW:OE-ARK2 GA	NWA:miRNA-ARK2 GA	NWB:miRNA-ARK2 GA	TW:miRNA-ARK2	TW:miRNA-ARK2 GA	TW 2hr	TW 8hr	TW 24hr	TW 48hr	TW 96hr	TW 336hr	WT ACC	35S::etr1-1 H20	35S::etr1-1 ACC	LMX5::etr1-1 H20	LMX5::etr1-1 ACC	WT-TW	TUA1dEY TW	TUA1dEY+TUB15 TW	TUA1dY+TUB9 TW	Pde TW	OW:WT	OW:WT GA	OW:OE-ARK2	OW:OE-ARK2 GA	OW:miRNA-ARK2	OW:miRNA-ARK2 GA	OW 2hr	OW 8hr	OW 24hr	OW 48hr	OW 96hr	OW 336hr	Root CTR	Root LongCold	Root LongDrougt	Root LongHeat	Root LongSalt	Root ShortCold	Root ShortDrougt	Root ShortHeat	Root ShortSalt	Ptr root	Leaf CTR	Leaf LongCold	Leaf LongDrougt	Leaf LongHeat	Leaf LongSalt	Leaf ShortCold	Leaf ShortDrougt	Leaf ShortHeat	Leaf ShortSalt	Ptr leaf	Stem CTR	Stem LongCold	Stem LongDrougt	Stem LongHeat	Stem LongSalt	Stem ShortCold	Stem ShortDrougt	Stem ShortHeat	Stem ShortSalt	Ptr shoot	Ptr xylem	Ptr phloem	Ptr fiber	Ptr vessel	Ptr fiber vessel ray
AT3G52090		NRPE11, NRPD11,...	DNA-directed RNA polymerase, R...		Potri.009G070900 [exp]	0	1	RPB13.1
AT1G11755		LEW1	LEAF WILTING 1, Undecaprenyl p...		Potri.004G152800 [exp]	1.73	0.8558
AT1G64230		UBC28	ubiquitin-conjugating enzyme 2...		Potri.001G094900 [exp]	3.87	0.8218	Pt-UBC.7
AT3G11750		FOLB1	Dihydroneopterin aldolase (.1)		Potri.016G067200 [exp]	8.71	0.8190
AT2G05630		ATG8D	Ubiquitin-like superfamily pro...		Potri.002G228800 [exp]	10.00	0.8476
AT2G27140			HSP20-like chaperones superfam...		Potri.004G191000 [exp]	15.93	0.8481
AT5G40380		CRK42	cysteine-rich RLK (RECEPTOR-li...		Potri.012G087000 [exp]	23.32	0.8213
AT3G47300		SELT	SELT-like protein precursor (....		Potri.001G253000 [exp]	25.92	0.8146
AT3G11530			Vacuolar protein sorting 55 (V...		Potri.006G209100 [exp]	27.49	0.7326
AT1G31340		NEDD8, ATRUB1, ...	ARABIDOPSIS THALIANA RELATED T...		Potri.005G096700 [exp]	27.92	0.7748	Pt-UBQ7.2
AT5G27720		LSM4, EMB1644	SM-like protein 4, embryo defe...		Potri.002G205700 [exp]	28.00	0.7470	Pt-GRP2.1

Compare expression of checked genes

Potri.009G070900 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.