Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser] Popgenie AspWood
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT4G31970 91 / 2e-22 CYP82C2, JAH1 "cytochrome P450, family 82, subfamily C, polypeptide 2", cytochrome P450, family 82, subfamily C, polypeptide 2 (.1) AT4G31940 89 / 6e-22 CYP82C4 "cytochrome P450, family 82, subfamily C, polypeptide 4", cytochrome P450, family 82, subfamily C, polypeptide 4 (.1) AT4G31950 89 / 8e-22 CYP82C3 "cytochrome P450, family 82, subfamily C, polypeptide 3", cytochrome P450, family 82, subfamily C, polypeptide 3 (.1) AT3G25180 69 / 1e-14 CYP82G1 cytochrome P450, family 82, subfamily G, polypeptide 1 (.1.2) AT2G23190 65 / 3e-13 CYP81D7 "cytochrome P450, family 81, subfamily D, polypeptide 7", cytochrome P450, family 81, subfamily D, polypeptide 7 (.1) AT2G25160 62 / 2e-12 CYP82F1 "cytochrome P450, family 82, subfamily F, polypeptide 1", cytochrome P450, family 82, subfamily F, polypeptide 1 (.1) AT4G37320 57 / 8e-11 CYP81D5 "cytochrome P450, family 81, subfamily D, polypeptide 5", cytochrome P450, family 81, subfamily D, polypeptide 5 (.1) AT4G37330 56 / 2e-10 CYP81D4 "cytochrome P450, family 81, subfamily D, polypeptide 4", cytochrome P450, family 81, subfamily D, polypeptide 4 (.1) AT4G37370 52 / 1e-08 CYP81D8 "cytochrome P450, family 81, subfamily D, polypeptide 8", cytochrome P450, family 81, subfamily D, polypeptide 8 (.1) AT3G20940 51 / 1e-08 CYP705A31P, CYP705A30 "cytochrome P450, family 705, subfamily A, polypeptide 30", cytochrome P450, family 705, subfamily A, polypeptide 30 (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.009G108600 [exp] 146 / 6e-43 AT4G31940 555 / 0.0 "cytochrome P450, family 82, subfamily C, polypeptide 4", cytochrome P450, family 82, subfamily C, polypeptide 4 (.1) Potri.014G037300 [exp] 106 / 5e-28 AT4G31940 629 / 0.0 "cytochrome P450, family 82, subfamily C, polypeptide 4", cytochrome P450, family 82, subfamily C, polypeptide 4 (.1) Potri.014G037500 [exp] 105 / 1e-27 AT4G31940 717 / 0.0 "cytochrome P450, family 82, subfamily C, polypeptide 4", cytochrome P450, family 82, subfamily C, polypeptide 4 (.1) Potri.014G037400 [exp] 100 / 5e-26 AT4G31940 476 / 4e-164 "cytochrome P450, family 82, subfamily C, polypeptide 4", cytochrome P450, family 82, subfamily C, polypeptide 4 (.1) Potri.014G037600 [exp] 100 / 9e-26 AT4G31940 478 / 7e-165 "cytochrome P450, family 82, subfamily C, polypeptide 4", cytochrome P450, family 82, subfamily C, polypeptide 4 (.1) Potri.014G037700 [exp] 100 / 1e-25 AT4G31940 508 / 1e-176 "cytochrome P450, family 82, subfamily C, polypeptide 4", cytochrome P450, family 82, subfamily C, polypeptide 4 (.1) Potri.014G037800 [exp] 100 / 1e-25 AT4G31940 495 / 9e-172 "cytochrome P450, family 82, subfamily C, polypeptide 4", cytochrome P450, family 82, subfamily C, polypeptide 4 (.1) Potri.001G334700 [exp] 96 / 3e-24 AT4G31970 459 / 1e-157 "cytochrome P450, family 82, subfamily C, polypeptide 2", cytochrome P450, family 82, subfamily C, polypeptide 2 (.1) Potri.014G038000 [exp] 94 / 1e-23 AT4G31940 514 / 5e-179 "cytochrome P450, family 82, subfamily C, polypeptide 4", cytochrome P450, family 82, subfamily C, polypeptide 4 (.1)
Flax homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10042922 [exp] 96 / 3e-26 AT4G31940 86 / 1e-25 "cytochrome P450, family 82, subfamily C, polypeptide 4", cytochrome P450, family 82, subfamily C, polypeptide 4 (.1) Lus10011657 [exp] 101 / 4e-26 AT4G31940 479 / 3e-160 "cytochrome P450, family 82, subfamily C, polypeptide 4", cytochrome P450, family 82, subfamily C, polypeptide 4 (.1) Lus10032743 [exp] 100 / 8e-26 AT4G31940 460 / 1e-157 "cytochrome P450, family 82, subfamily C, polypeptide 4", cytochrome P450, family 82, subfamily C, polypeptide 4 (.1) Lus10032745 [exp] 94 / 1e-23 AT4G31940 571 / 0.0 "cytochrome P450, family 82, subfamily C, polypeptide 4", cytochrome P450, family 82, subfamily C, polypeptide 4 (.1) Lus10002357 [exp] 93 / 3e-23 AT4G31940 432 / 2e-146 "cytochrome P450, family 82, subfamily C, polypeptide 4", cytochrome P450, family 82, subfamily C, polypeptide 4 (.1) Lus10007837 [exp] 92 / 5e-23 AT4G31940 575 / 0.0 "cytochrome P450, family 82, subfamily C, polypeptide 4", cytochrome P450, family 82, subfamily C, polypeptide 4 (.1) Lus10003148 [exp] 91 / 1e-22 AT4G31940 430 / 3e-146 "cytochrome P450, family 82, subfamily C, polypeptide 4", cytochrome P450, family 82, subfamily C, polypeptide 4 (.1) Lus10035635 [exp] 89 / 1e-21 AT4G31940 470 / 8e-162 "cytochrome P450, family 82, subfamily C, polypeptide 4", cytochrome P450, family 82, subfamily C, polypeptide 4 (.1) Lus10025902 [exp] 87 / 3e-21 AT4G31940 449 / 1e-153 "cytochrome P450, family 82, subfamily C, polypeptide 4", cytochrome P450, family 82, subfamily C, polypeptide 4 (.1) Lus10010758 [exp] 86 / 1e-20 AT4G31970 346 / 1e-114 "cytochrome P450, family 82, subfamily C, polypeptide 2", cytochrome P450, family 82, subfamily C, polypeptide 2 (.1)
PFAM info	Clan ID Clan name Pfam ID Pfam name Pfam description PF00067 [poplar] [flax] p450 Cytochrome P450
Representative CDS sequence Show only first row Show all	>Potri.009G108766.1 pacid=42771117 polypeptide=Potri.009G108766.1.p locus=Potri.009G108766 ID=Potri.009G108766.1.v4.1 annot-version=v4.1 ATGAAAACCTTAATTGAGCTACGAGAAATCTCCTTTTTTGCCCTTCTTCTTGCAATAATTTCTGTTGTCTTGGCCACAATATGTGCCAAAGGAAACAAGA AAAGTGGCAAGATGCCTCCAGAGGTAGCAGGGTCATGGCCTGTTATTGGCCACCTACATCTTCTTGGAGGAAGAAACCAGCTGCTGCATAAAACACTAGG GGGCATGGCAGATAAGTATGGGTCAATCTTCTCTATCCGCCTTGGAATTCATCCAACAATTGTGGTGAGCGATTGGGAAATTGTGAAAGAATGTTTCACT GCAAATGATAGGGTCTTTCCACACGTCCGAAATTCTTAG
AA sequence Show only first row Show all	>Potri.009G108766.1 pacid=42771117 polypeptide=Potri.009G108766.1.p locus=Potri.009G108766 ID=Potri.009G108766.1.v4.1 annot-version=v4.1 MKTLIELREISFFALLLAIISVVLATICAKGNKKSGKMPPEVAGSWPVIGHLHLLGGRNQLLHKTLGGMADKYGSIFSIRLGIHPTIVVSDWEIVKECFT ANDRVFPHVRNS

---

DESeq2's median of ratios [POPLAR]

Mapped by: StringTie Salmon Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	NWA:WT	NWB:WT	NWA:OE-ARK2	NWB:OE-ARK2	NWA:miRNA-ARK2	NWB:miRNA-ARK2	NW 0hr	WT H20	WT-NW	TUA1dEY NW	TUA1dEY+TUB15 NW	TUA1dY+TUB9 NW	Pde NW	NWA:WT GA	NWBWT GA	TW:WT	TW:WT GA	NWA:OE-ARK2 GA	NWB:OE-ARK2 GA	TW:OE-ARK2	TW:OE-ARK2 GA	NWA:miRNA-ARK2 GA	NWB:miRNA-ARK2 GA	TW:miRNA-ARK2	TW:miRNA-ARK2 GA	TW 2hr	TW 8hr	TW 24hr	TW 48hr	TW 96hr	TW 336hr	WT ACC	35S::etr1-1 H20	35S::etr1-1 ACC	LMX5::etr1-1 H20	LMX5::etr1-1 ACC	WT-TW	TUA1dEY TW	TUA1dEY+TUB15 TW	TUA1dY+TUB9 TW	Pde TW	OW:WT	OW:WT GA	OW:OE-ARK2	OW:OE-ARK2 GA	OW:miRNA-ARK2	OW:miRNA-ARK2 GA	OW 2hr	OW 8hr	OW 24hr	OW 48hr	OW 96hr	OW 336hr	Root CTR	Root LongCold	Root LongDrougt	Root LongHeat	Root LongSalt	Root ShortCold	Root ShortDrougt	Root ShortHeat	Root ShortSalt	Ptr root	Leaf CTR	Leaf LongCold	Leaf LongDrougt	Leaf LongHeat	Leaf LongSalt	Leaf ShortCold	Leaf ShortDrougt	Leaf ShortHeat	Leaf ShortSalt	Ptr leaf	Stem CTR	Stem LongCold	Stem LongDrougt	Stem LongHeat	Stem LongSalt	Stem ShortCold	Stem ShortDrougt	Stem ShortHeat	Stem ShortSalt	Ptr shoot	Ptr xylem	Ptr phloem	Ptr fiber	Ptr vessel	Ptr fiber vessel ray
AT4G31970		CYP82C2, JAH1	"cytochrome P450, family 82, s...		Potri.009G108766 [exp]	0	1
AT1G53440			Leucine-rich repeat transmembr...		Potri.016G011601 [exp]	5.47	0.9836
AT5G44120		ATCRA1, CRU1, C...	CRUCIFERINA, RmlC-like cupins ...		Potri.019G004400 [exp]	10.39	0.9795
AT4G05030			Copper transport protein famil...		Potri.016G002600 [exp]	10.95	0.9757
AT3G05660		AtRLP33	receptor like protein 33 (.1)		Potri.011G021216 [exp]	11.95	0.9726
AT1G62280		SLAH1	SLAC1 homologue 1 (.1)		Potri.002G227800 [exp]	14.45	0.9736
AT1G03670			ankyrin repeat family protein ...		Potri.018G077633 [exp]	19.18	0.9701
AT1G53440			Leucine-rich repeat transmembr...		Potri.016G012150 [exp]	19.44	0.9714
AT1G53440			Leucine-rich repeat transmembr...		Potri.010G155150 [exp]	20.49	0.9733
AT2G30070		ATKUP1, ATKT1P,...	POTASSIUM UPTAKE TRANSPORTER 1...		Potri.007G068200 [exp]	22.27	0.9721
					Potri.007G003150 [exp]	23.06	0.9388

Compare expression of checked genes

Potri.009G108766 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.