Potri.009G111815 [POPLAR]


External link
JGI Phytozome v13PopgenieAspWood                  
Symbol
Arabidopsis homologues

No hit found

Paralogs
Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description
Potri.009G111938 149 / 2e-48 ND /
Potri.T124904 97 / 7e-28 ND /
Potri.T124804 72 / 2e-18 ND /
Potri.017G111100 44 / 5e-07 ND /
Potri.017G110800 40 / 2e-05 ND /
Potri.017G111150 39 / 2e-05 ND /
Potri.017G111225 39 / 3e-05 ND /
Potri.017G110900 38 / 4e-05 ND /
Potri.017G111000 38 / 5e-05 ND /
Flax homologues

No hit found

PFAM info
Representative CDS sequence
>Potri.009G111815.1 pacid=42771672 polypeptide=Potri.009G111815.1.p locus=Potri.009G111815 ID=Potri.009G111815.1.v4.1 annot-version=v4.1
ATGATAAACACAAATATTTCAAACATGAAAGCCTTTCTTGTGATCATATGCATTCTCTTAGCAACCATCGTCTTCTCTGATCCCTCATCCACCAGTGCTG
CTCGAGAATTACTGCAGGTCGGGAAAGATCCATATAGGGGATCTGGCCCCGTCAATTCAGGACCTCCATGCGGTAGTAGCAAACAAAGTTGCCACCCCAG
TCCAAAGCCAGGACCAAATAAACCAAAAAAACACTGTGAATCTTCTGCTAGGCAATCTGATTGTGGCCCAAATTGA
AA sequence
>Potri.009G111815.1 pacid=42771672 polypeptide=Potri.009G111815.1.p locus=Potri.009G111815 ID=Potri.009G111815.1.v4.1 annot-version=v4.1
MINTNISNMKAFLVIICILLATIVFSDPSSTSAARELLQVGKDPYRGSGPVNSGPPCGSSKQSCHPSPKPGPNKPKKHCESSARQSDCGPN

DESeq2's median of ratios [POPLAR]

Mapped by: Order by: Show schematic diagram

Coexpressed genes

Only top 10 genes are shown Show allDownload tab-delimited text
Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.
At best At TF class At alias At description Locus MR r Symbol NWA:WTNWB:WTNWA:OE-ARK2NWB:OE-ARK2NWA:miRNA-ARK2NWB:miRNA-ARK2NW 0hrWT H20WT-NWTUA1dEY NWTUA1dEY+TUB15 NWTUA1dY+TUB9 NWPde NWNWA:WT GANWBWT GATW:WTTW:WT GANWA:OE-ARK2 GANWB:OE-ARK2 GATW:OE-ARK2TW:OE-ARK2 GANWA:miRNA-ARK2 GANWB:miRNA-ARK2 GATW:miRNA-ARK2TW:miRNA-ARK2 GATW 2hrTW 8hrTW 24hrTW 48hrTW 96hrTW 336hrWT ACC35S::etr1-1 H2035S::etr1-1 ACCLMX5::etr1-1 H20LMX5::etr1-1 ACCWT-TWTUA1dEY TWTUA1dEY+TUB15 TWTUA1dY+TUB9 TWPde TWOW:WTOW:WT GAOW:OE-ARK2OW:OE-ARK2 GAOW:miRNA-ARK2OW:miRNA-ARK2 GAOW 2hrOW 8hrOW 24hrOW 48hrOW 96hrOW 336hrRoot CTRRoot LongColdRoot LongDrougtRoot LongHeatRoot LongSaltRoot ShortColdRoot ShortDrougtRoot ShortHeatRoot ShortSaltPtr rootLeaf CTRLeaf LongColdLeaf LongDrougtLeaf LongHeatLeaf LongSaltLeaf ShortColdLeaf ShortDrougtLeaf ShortHeatLeaf ShortSaltPtr leafStem CTRStem LongColdStem LongDrougtStem LongHeatStem LongSaltStem ShortColdStem ShortDrougtStem ShortHeatStem ShortSaltPtr shootPtr xylemPtr phloemPtr fiberPtr vesselPtr fiber vessel ray
Potri.009G111815 0 1
AT1G45616 AtRLP6 receptor like protein 6 (.1) Potri.009G112061 1.73 0.9512
Potri.009G111938 1.73 0.9271
Potri.006G038100 3.87 0.8723
AT3G10720 Plant invertase/pectin methyle... Potri.010G247700 13.78 0.8311
AT4G21410 CRK29 cysteine-rich RLK (RECEPTOR-li... Potri.011G029000 21.33 0.8579
AT4G21410 CRK29 cysteine-rich RLK (RECEPTOR-li... Potri.011G030000 29.79 0.8488
AT1G52190 Major facilitator superfamily ... Potri.018G041600 30.98 0.8375
AT4G10780 LRR and NB-ARC domains-contain... Potri.001G405025 32.68 0.8713
AT4G21410 CRK29 cysteine-rich RLK (RECEPTOR-li... Potri.011G029700 33.40 0.8464
AT1G52190 Major facilitator superfamily ... Potri.018G041500 34.24 0.8201

Potri.009G111815 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.