Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser] Popgenie AspWood
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT5G20950 110 / 1e-29 Glycosyl hydrolase family protein (.1.2) AT5G20940 109 / 2e-29 Glycosyl hydrolase family protein (.1) AT5G04885 102 / 8e-27 Glycosyl hydrolase family protein (.1) AT3G62710 85 / 1e-20 Glycosyl hydrolase family protein (.1) AT3G47050 76 / 1e-17 Glycosyl hydrolase family protein (.1.2) AT3G47000 76 / 2e-17 Glycosyl hydrolase family protein (.1) AT3G47010 73 / 1e-16 Glycosyl hydrolase family protein (.1.2) AT3G47040 73 / 2e-16 Glycosyl hydrolase family protein (.1.2) AT5G10560 41 / 4e-05 Glycosyl hydrolase family protein (.1) AT5G49360 37 / 0.0006 ATBXL1, BXL1 beta-xylosidase 1 (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.009G154701 [exp] 120 / 6e-36 AT5G04885 286 / 6e-94 Glycosyl hydrolase family protein (.1) Potri.013G055600 [exp] 122 / 1e-33 AT5G20950 932 / 0.0 Glycosyl hydrolase family protein (.1.2) Potri.019G037400 [exp] 118 / 2e-32 AT5G20950 926 / 0.0 Glycosyl hydrolase family protein (.1.2) Potri.008G013500 [exp] 118 / 2e-32 AT5G04885 966 / 0.0 Glycosyl hydrolase family protein (.1) Potri.008G013700 [exp] 112 / 3e-30 AT5G20950 901 / 0.0 Glycosyl hydrolase family protein (.1.2) Potri.009G153900 [exp] 108 / 7e-29 AT5G20950 937 / 0.0 Glycosyl hydrolase family protein (.1.2) Potri.009G042800 [exp] 83 / 8e-20 AT3G47000 934 / 0.0 Glycosyl hydrolase family protein (.1) Potri.005G168400 [exp] 39 / 0.0002 AT1G78060 981 / 0.0 Glycosyl hydrolase family protein (.1) Potri.001G089100 [exp] 38 / 0.0005 AT5G10560 988 / 0.0 Glycosyl hydrolase family protein (.1)
Flax homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10033393 [exp] 115 / 2e-31 AT5G04885 964 / 0.0 Glycosyl hydrolase family protein (.1) Lus10034848 [exp] 115 / 3e-31 AT5G20950 823 / 0.0 Glycosyl hydrolase family protein (.1.2) Lus10013646 [exp] 111 / 5e-30 AT5G20950 941 / 0.0 Glycosyl hydrolase family protein (.1.2) Lus10010656 [exp] 111 / 7e-30 AT5G20950 897 / 0.0 Glycosyl hydrolase family protein (.1.2) Lus10008432 [exp] 110 / 9e-30 AT5G20950 927 / 0.0 Glycosyl hydrolase family protein (.1.2) Lus10001151 [exp] 110 / 1e-29 AT5G20950 911 / 0.0 Glycosyl hydrolase family protein (.1.2) Lus10013388 [exp] 109 / 3e-29 AT5G04885 801 / 0.0 Glycosyl hydrolase family protein (.1) Lus10013390 [exp] 108 / 4e-29 AT5G20950 935 / 0.0 Glycosyl hydrolase family protein (.1.2) Lus10008434 [exp] 107 / 2e-28 AT5G04885 796 / 0.0 Glycosyl hydrolase family protein (.1) Lus10010657 [exp] 106 / 5e-28 AT5G20950 889 / 0.0 Glycosyl hydrolase family protein (.1.2)
PFAM info	Clan ID Clan name Pfam ID Pfam name Pfam description CL0058 [poplar] [flax] Glyco_hydro_tim PF00933 [poplar] [flax] Glyco_hydro_3 Glycosyl hydrolase family 3 N terminal domain
Representative CDS sequence Show only first row Show all	>Potri.009G153966.1 pacid=42772793 polypeptide=Potri.009G153966.1.p locus=Potri.009G153966 ID=Potri.009G153966.1.v4.1 annot-version=v4.1 ATGGAGAATGGTTTTGGTATTCCTTACGTTTTTGCTCCATGCATTGCGGTTTGTAGAGATCCCAGATGGGGTAGGTGCTATGAGAGCTATAGTGAGAATC CTAAAGTTGTTGAAATGATGACAGAGATTATACCTGGATTGCAAGGTGATGTTCCTCCAGATTCCAGAAAGGGTGTTCCCTGTGTTGGTGGAAAGACAAA GTTGCAGCCTGTGCGAAGCACTTTGTTGGCGATGGGGGCACCACCAAGGGCATTAACGAGAACAATATTGTTATTGGCTACCATGGATTGA
AA sequence Show only first row Show all	>Potri.009G153966.1 pacid=42772793 polypeptide=Potri.009G153966.1.p locus=Potri.009G153966 ID=Potri.009G153966.1.v4.1 annot-version=v4.1 MENGFGIPYVFAPCIAVCRDPRWGRCYESYSENPKVVEMMTEIIPGLQGDVPPDSRKGVPCVGGKTKLQPVRSTLLAMGAPPRALTRTILLLATMD

---

DESeq2's median of ratios [POPLAR]

Mapped by: StringTie Salmon Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	NWA:WT	NWB:WT	NWA:OE-ARK2	NWB:OE-ARK2	NWA:miRNA-ARK2	NWB:miRNA-ARK2	NW 0hr	WT H20	WT-NW	TUA1dEY NW	TUA1dEY+TUB15 NW	TUA1dY+TUB9 NW	Pde NW	NWA:WT GA	NWBWT GA	TW:WT	TW:WT GA	NWA:OE-ARK2 GA	NWB:OE-ARK2 GA	TW:OE-ARK2	TW:OE-ARK2 GA	NWA:miRNA-ARK2 GA	NWB:miRNA-ARK2 GA	TW:miRNA-ARK2	TW:miRNA-ARK2 GA	TW 2hr	TW 8hr	TW 24hr	TW 48hr	TW 96hr	TW 336hr	WT ACC	35S::etr1-1 H20	35S::etr1-1 ACC	LMX5::etr1-1 H20	LMX5::etr1-1 ACC	WT-TW	TUA1dEY TW	TUA1dEY+TUB15 TW	TUA1dY+TUB9 TW	Pde TW	OW:WT	OW:WT GA	OW:OE-ARK2	OW:OE-ARK2 GA	OW:miRNA-ARK2	OW:miRNA-ARK2 GA	OW 2hr	OW 8hr	OW 24hr	OW 48hr	OW 96hr	OW 336hr	Root CTR	Root LongCold	Root LongDrougt	Root LongHeat	Root LongSalt	Root ShortCold	Root ShortDrougt	Root ShortHeat	Root ShortSalt	Ptr root	Leaf CTR	Leaf LongCold	Leaf LongDrougt	Leaf LongHeat	Leaf LongSalt	Leaf ShortCold	Leaf ShortDrougt	Leaf ShortHeat	Leaf ShortSalt	Ptr leaf	Stem CTR	Stem LongCold	Stem LongDrougt	Stem LongHeat	Stem LongSalt	Stem ShortCold	Stem ShortDrougt	Stem ShortHeat	Stem ShortSalt	Ptr shoot	Ptr xylem	Ptr phloem	Ptr fiber	Ptr vessel	Ptr fiber vessel ray
AT5G20950			Glycosyl hydrolase family prot...		Potri.009G153966 [exp]	0	1

Compare expression of checked genes

Potri.009G153966 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.