Potri.010G112701 [POPLAR]


External link
JGI Phytozome v13PopgenieAspWood                  
Symbol
Arabidopsis homologues

No hit found

Paralogs
Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description
Flax homologues

No hit found

PFAM info
Representative CDS sequence
>Potri.010G112701.1 pacid=42796949 polypeptide=Potri.010G112701.1.p locus=Potri.010G112701 ID=Potri.010G112701.1.v4.1 annot-version=v4.1
ATGGTTCACTCACCGTCCCCAGGAATTAAAAGGATGCAGGGCCTGTGGATTGGTAAAAGAGCTCTGATGAGAAAAGTAAATGGGCCGTAA
AA sequence
>Potri.010G112701.1 pacid=42796949 polypeptide=Potri.010G112701.1.p locus=Potri.010G112701 ID=Potri.010G112701.1.v4.1 annot-version=v4.1
MVHSPSPGIKRMQGLWIGKRALMRKVNGP

DESeq2's median of ratios [POPLAR]

Mapped by: Order by: Show schematic diagram

Coexpressed genes

Only top 10 genes are shown Show allDownload tab-delimited text
Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.
At best At TF class At alias At description Locus MR r Symbol NWA:WTNWB:WTNWA:OE-ARK2NWB:OE-ARK2NWA:miRNA-ARK2NWB:miRNA-ARK2NW 0hrWT H20WT-NWTUA1dEY NWTUA1dEY+TUB15 NWTUA1dY+TUB9 NWPde NWNWA:WT GANWBWT GATW:WTTW:WT GANWA:OE-ARK2 GANWB:OE-ARK2 GATW:OE-ARK2TW:OE-ARK2 GANWA:miRNA-ARK2 GANWB:miRNA-ARK2 GATW:miRNA-ARK2TW:miRNA-ARK2 GATW 2hrTW 8hrTW 24hrTW 48hrTW 96hrTW 336hrWT ACC35S::etr1-1 H2035S::etr1-1 ACCLMX5::etr1-1 H20LMX5::etr1-1 ACCWT-TWTUA1dEY TWTUA1dEY+TUB15 TWTUA1dY+TUB9 TWPde TWOW:WTOW:WT GAOW:OE-ARK2OW:OE-ARK2 GAOW:miRNA-ARK2OW:miRNA-ARK2 GAOW 2hrOW 8hrOW 24hrOW 48hrOW 96hrOW 336hrRoot CTRRoot LongColdRoot LongDrougtRoot LongHeatRoot LongSaltRoot ShortColdRoot ShortDrougtRoot ShortHeatRoot ShortSaltPtr rootLeaf CTRLeaf LongColdLeaf LongDrougtLeaf LongHeatLeaf LongSaltLeaf ShortColdLeaf ShortDrougtLeaf ShortHeatLeaf ShortSaltPtr leafStem CTRStem LongColdStem LongDrougtStem LongHeatStem LongSaltStem ShortColdStem ShortDrougtStem ShortHeatStem ShortSaltPtr shootPtr xylemPtr phloemPtr fiberPtr vesselPtr fiber vessel ray
Potri.010G112701 0 1
Potri.016G068650 8.00 0.9165
Potri.018G001950 10.24 0.8880
AT1G20440 AtCOR47, RD17, ... cold-regulated 47 (.1) Potri.002G013200 13.56 0.8879
AT2G46140 Late embryogenesis abundant pr... Potri.002G165000 15.42 0.8647 PM22.2
AT5G46540 ABCB7, PGP7 ATP-binding cassette B7, P-gly... Potri.006G071901 18.00 0.6727
AT3G44610 Protein kinase superfamily pro... Potri.009G146500 18.43 0.8819
AT5G16970 AT-AER alkenal reductase (.1) Potri.007G143700 20.63 0.8775
AT2G29110 ATGLR2.8 glutamate receptor 2.8 (.1) Potri.006G172100 24.24 0.8766
AT2G29110 ATGLR2.8 glutamate receptor 2.8 (.1) Potri.006G174202 25.61 0.8764
Potri.001G088750 26.72 0.8589

Potri.010G112701 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.