Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser] Popgenie AspWood
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT3G06520 70 / 2e-15 agenet domain-containing protein (.1) AT1G09320 63 / 8e-13 agenet domain-containing protein (.1) AT1G11420 47 / 3e-07 ATDUF2 DOMAIN OF UNKNOWN FUNCTION 724 2 (.1) AT2G47230 42 / 2e-05 ATDUF6 DOMAIN OF UNKNOWN FUNCTION 724 6 (.1.2) AT1G03300 41 / 4e-05 ATDUF1 DOMAIN OF UNKNOWN FUNCTION 724 1 (.1) AT1G26540 38 / 0.0004 Agenet domain-containing protein (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.005G011100 [exp] 65 / 1e-13 AT1G09320 264 / 3e-84 agenet domain-containing protein (.1) Potri.013G006900 [exp] 64 / 3e-13 AT1G09320 268 / 1e-85 agenet domain-containing protein (.1) Potri.014G117800 [exp] 54 / 9e-10 AT1G11420 194 / 1e-52 DOMAIN OF UNKNOWN FUNCTION 724 2 (.1) Potri.002G192300 [exp] 52 / 8e-09 AT1G26540 201 / 3e-54 Agenet domain-containing protein (.1) Potri.009G151200 [exp] 47 / 9e-08 AT1G06340 141 / 3e-44 Plant Tudor-like protein (.1) Potri.009G072600 [exp] 44 / 3e-06 AT5G58610 453 / 1e-139 PHD finger transcription factor, putative (.1)
Flax homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10017088 [exp] 89 / 5e-22 AT3G06520 283 / 1e-90 agenet domain-containing protein (.1) Lus10037805 [exp] 84 / 3e-20 AT3G06520 271 / 9e-86 agenet domain-containing protein (.1) Lus10000615 [exp] 59 / 2e-11 AT1G16890 286 / 9e-95 UBIQUITIN CONJUGATING ENZYME 13B, ubiquitin-conjugating enzyme 36 (.1.2.3) Lus10000353 [exp] 59 / 2e-11 AT1G16890 313 / 3e-103 UBIQUITIN CONJUGATING ENZYME 13B, ubiquitin-conjugating enzyme 36 (.1.2.3) Lus10010903 [exp] 54 / 9e-10 AT1G09320 136 / 3e-35 agenet domain-containing protein (.1) Lus10031429 [exp] 54 / 2e-09 AT1G09320 131 / 2e-33 agenet domain-containing protein (.1) Lus10027325 [exp] 49 / 3e-08 AT1G06340 95 / 2e-25 Plant Tudor-like protein (.1) Lus10039027 [exp] 43 / 5e-06 AT1G06340 91 / 7e-24 Plant Tudor-like protein (.1) Lus10009266 [exp] 43 / 5e-06 AT1G06340 86 / 2e-21 Plant Tudor-like protein (.1) Lus10010060 [exp] 40 / 0.0001 AT2G47230 168 / 2e-43 DOMAIN OF UNKNOWN FUNCTION 724 6 (.1.2)
PFAM info	Clan ID Clan name Pfam ID Pfam name Pfam description CL0049 [poplar] [flax] Tudor PF05641 [poplar] [flax] Agenet Agenet domain
Representative CDS sequence Show only first row Show all	>Potri.010G149301.1 pacid=42797107 polypeptide=Potri.010G149301.1.p locus=Potri.010G149301 ID=Potri.010G149301.1.v4.1 annot-version=v4.1 ATGGAATTTGAACATGCTAGGTTGAGACCTCATCAAGATTGGATTAATGGAAAATGGATCAAGGAAGAGTCAATTGTGTTGGAGGGTAATGGAAGGACTC CAAAACCCAAGTTCAGCAAGGGAACAAGGGTGGAGGTCAAAAGTGAAGAAGTTGGTTTCCAGGGTTCTTGGTACTCTGCAACCATTGTGGAAGTGATGGA GAATGACAAATTTCTGGTTCAATATCACAACCTTGTAACAGATGATGAAACTGGTTCCCTTAGACATAAGGCCTTCACACCCTCGTATTCAACGTGCCTA CGCTTTTGA
AA sequence Show only first row Show all	>Potri.010G149301.1 pacid=42797107 polypeptide=Potri.010G149301.1.p locus=Potri.010G149301 ID=Potri.010G149301.1.v4.1 annot-version=v4.1 MEFEHARLRPHQDWINGKWIKEESIVLEGNGRTPKPKFSKGTRVEVKSEEVGFQGSWYSATIVEVMENDKFLVQYHNLVTDDETGSLRHKAFTPSYSTCL RF

---

DESeq2's median of ratios [POPLAR]

Mapped by: StringTie Salmon Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	NWA:WT	NWB:WT	NWA:OE-ARK2	NWB:OE-ARK2	NWA:miRNA-ARK2	NWB:miRNA-ARK2	NW 0hr	WT H20	WT-NW	TUA1dEY NW	TUA1dEY+TUB15 NW	TUA1dY+TUB9 NW	Pde NW	NWA:WT GA	NWBWT GA	TW:WT	TW:WT GA	NWA:OE-ARK2 GA	NWB:OE-ARK2 GA	TW:OE-ARK2	TW:OE-ARK2 GA	NWA:miRNA-ARK2 GA	NWB:miRNA-ARK2 GA	TW:miRNA-ARK2	TW:miRNA-ARK2 GA	TW 2hr	TW 8hr	TW 24hr	TW 48hr	TW 96hr	TW 336hr	WT ACC	35S::etr1-1 H20	35S::etr1-1 ACC	LMX5::etr1-1 H20	LMX5::etr1-1 ACC	WT-TW	TUA1dEY TW	TUA1dEY+TUB15 TW	TUA1dY+TUB9 TW	Pde TW	OW:WT	OW:WT GA	OW:OE-ARK2	OW:OE-ARK2 GA	OW:miRNA-ARK2	OW:miRNA-ARK2 GA	OW 2hr	OW 8hr	OW 24hr	OW 48hr	OW 96hr	OW 336hr	Root CTR	Root LongCold	Root LongDrougt	Root LongHeat	Root LongSalt	Root ShortCold	Root ShortDrougt	Root ShortHeat	Root ShortSalt	Ptr root	Leaf CTR	Leaf LongCold	Leaf LongDrougt	Leaf LongHeat	Leaf LongSalt	Leaf ShortCold	Leaf ShortDrougt	Leaf ShortHeat	Leaf ShortSalt	Ptr leaf	Stem CTR	Stem LongCold	Stem LongDrougt	Stem LongHeat	Stem LongSalt	Stem ShortCold	Stem ShortDrougt	Stem ShortHeat	Stem ShortSalt	Ptr shoot	Ptr xylem	Ptr phloem	Ptr fiber	Ptr vessel	Ptr fiber vessel ray
AT3G06520			agenet domain-containing prote...		Potri.010G149301 [exp]	0	1
AT1G02460			Pectin lyase-like superfamily ...		Potri.005G005500 [exp]	3.74	0.7807
AT5G35110			unknown protein		Potri.018G113700 [exp]	6.70	0.7393
AT1G63440		HMA5	heavy metal atpase 5 (.1)		Potri.003G204801 [exp]	9.48	0.7674
AT5G40010		ASD, AATP1	ATPase-in-Seed-Development, AA...		Potri.015G067400 [exp]	11.95	0.6898
AT1G07985			Expressed protein (.1)		Potri.001G266500 [exp]	16.24	0.7050
AT1G30820			CTP synthase family protein (....		Potri.001G073100 [exp]	18.00	0.7467
					Potri.006G219750 [exp]	21.16	0.7457
AT4G16990		RLM3	RESISTANCE TO LEPTOSPHAERIA MA...		Potri.013G085201 [exp]	32.52	0.6813
AT2G35790			unknown protein		Potri.008G042800 [exp]	39.26	0.7297
					Potri.017G080900 [exp]	42.95	0.7004

Compare expression of checked genes

Potri.010G149301 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.