Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser] Popgenie AspWood
Symbol	Pt-HSP18.4
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT5G59720 189 / 2e-62 HSP18.2 HSP18.1CI heat shock protein 18.2 (.1) AT1G53540 187 / 8e-62 HSP20-like chaperones superfamily protein (.1) AT3G46230 183 / 5e-60 ATHSP17.4 ARABIDOPSIS THALIANA HEAT SHOCK PROTEIN 17.4, heat shock protein 17.4 (.1) AT2G29500 175 / 7e-57 HSP20-like chaperones superfamily protein (.1) AT1G07400 167 / 6e-54 HSP20-like chaperones superfamily protein (.1) AT1G59860 149 / 9e-47 HSP20-like chaperones superfamily protein (.1) AT4G10250 98 / 4e-26 ATHSP22.0 HSP20-like chaperones superfamily protein (.1) AT5G37670 78 / 6e-19 HSP15.7CI HSP20-like chaperones superfamily protein (.1) AT5G12020 75 / 2e-17 HSP17.6II 17.6 kDa class II heat shock protein (.1) AT5G12030 71 / 7e-16 AT-HSP17.6A heat shock protein 17.6A (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.008G062350 [exp] 246 / 1e-84 AT5G59720 196 / 3e-65 heat shock protein 18.2 (.1) Potri.008G062300 [exp] 245 / 2e-84 AT5G59720 198 / 9e-66 heat shock protein 18.2 (.1) Potri.001G238700 [exp] 201 / 5e-67 AT1G53540 195 / 8e-65 HSP20-like chaperones superfamily protein (.1) Potri.009G039200 [exp] 187 / 1e-61 AT1G07400 201 / 3e-67 HSP20-like chaperones superfamily protein (.1) Potri.004G187450 [exp] 184 / 2e-60 AT2G29500 221 / 5e-75 HSP20-like chaperones superfamily protein (.1) Potri.004G187400 [exp] 181 / 2e-59 AT1G07400 193 / 7e-64 HSP20-like chaperones superfamily protein (.1) Potri.019G081200 [exp] 181 / 2e-59 AT2G29500 186 / 3e-61 HSP20-like chaperones superfamily protein (.1) Potri.004G187202 [exp] 181 / 3e-59 AT2G29500 209 / 1e-70 HSP20-like chaperones superfamily protein (.1) Potri.009G147900 [exp] 180 / 1e-58 AT2G29500 193 / 5e-64 HSP20-like chaperones superfamily protein (.1)
Flax homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10040723 [exp] 177 / 9e-58 AT2G29500 219 / 3e-74 HSP20-like chaperones superfamily protein (.1) Lus10009085 [exp] 177 / 2e-57 AT1G53540 232 / 2e-79 HSP20-like chaperones superfamily protein (.1) Lus10040722 [exp] 173 / 8e-56 AT1G07400 214 / 2e-72 HSP20-like chaperones superfamily protein (.1) Lus10016457 [exp] 170 / 1e-54 AT1G07400 216 / 4e-73 HSP20-like chaperones superfamily protein (.1) Lus10040830 [exp] 169 / 2e-54 AT1G53540 236 / 6e-81 HSP20-like chaperones superfamily protein (.1) Lus10016456 [exp] 165 / 9e-53 AT1G07400 213 / 8e-72 HSP20-like chaperones superfamily protein (.1) Lus10016458 [exp] 158 / 4e-50 AT2G29500 214 / 3e-72 HSP20-like chaperones superfamily protein (.1) Lus10026262 [exp] 109 / 3e-30 AT4G10250 152 / 5e-47 HSP20-like chaperones superfamily protein (.1) Lus10042408 [exp] 104 / 2e-28 AT4G10250 154 / 1e-47 HSP20-like chaperones superfamily protein (.1) Lus10040560 [exp] 99 / 2e-26 AT4G10250 200 / 1e-65 HSP20-like chaperones superfamily protein (.1)
PFAM info	Clan ID Clan name Pfam ID Pfam name Pfam description CL0190 [poplar] [flax] HSP20 PF00011 [poplar] [flax] HSP20 Hsp20/alpha crystallin family
Representative CDS sequence Show only first row Show all	>Potri.010G195700.1 pacid=42799613 polypeptide=Potri.010G195700.1.p locus=Potri.010G195700 ID=Potri.010G195700.1.v4.1 annot-version=v4.1 ATGTCTCTTATCCCAAGCACCCTCTTTGGTGGCCGAAGAAGTAACATCTTTGATCCTTTCTCTCTTGACATCTGGGACCCTTTCCAGGACTTTCCCTTCA CTAGCACAGCCATATCAGCCCCACGATCAGAGTTCGCCAACGAAACAACGGCATTTGCCAACACACGCATAGACTGGAAGGAGACCCCCGAGGCTCACGT TTTCAAGGCTGATCTCCCAGGCCTGAAGAAAGAGGAAGTCAAAGTGGAGTTAGAGGAAGGCAGGGTTTTGCAAATAAGTGGAGAGAGAAGCAAAGAGAGA GAAGAGAAAAATGACAAGTGGCATAGAGTGGAGAGGTCAAGTGGGAAGTTCTTAAGGAGATTCAGGTTGCCTGAGAATGCAAAACTTGATCAACTTAAGG CTAATATGGAAAACGGGGTCTTGACTGTGACTGTGCCTAAAGAGGAAGTCAAAAAACCTGATGTTAAGGCCATCGAGATCACCGGCTGA
AA sequence Show only first row Show all	>Potri.010G195700.1 pacid=42799613 polypeptide=Potri.010G195700.1.p locus=Potri.010G195700 ID=Potri.010G195700.1.v4.1 annot-version=v4.1 MSLIPSTLFGGRRSNIFDPFSLDIWDPFQDFPFTSTAISAPRSEFANETTAFANTRIDWKETPEAHVFKADLPGLKKEEVKVELEEGRVLQISGERSKER EEKNDKWHRVERSSGKFLRRFRLPENAKLDQLKANMENGVLTVTVPKEEVKKPDVKAIEITG

---

DESeq2's median of ratios [POPLAR]

Mapped by: StringTie Salmon Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	NWA:WT	NWB:WT	NWA:OE-ARK2	NWB:OE-ARK2	NWA:miRNA-ARK2	NWB:miRNA-ARK2	NW 0hr	WT H20	WT-NW	TUA1dEY NW	TUA1dEY+TUB15 NW	TUA1dY+TUB9 NW	Pde NW	NWA:WT GA	NWBWT GA	TW:WT	TW:WT GA	NWA:OE-ARK2 GA	NWB:OE-ARK2 GA	TW:OE-ARK2	TW:OE-ARK2 GA	NWA:miRNA-ARK2 GA	NWB:miRNA-ARK2 GA	TW:miRNA-ARK2	TW:miRNA-ARK2 GA	TW 2hr	TW 8hr	TW 24hr	TW 48hr	TW 96hr	TW 336hr	WT ACC	35S::etr1-1 H20	35S::etr1-1 ACC	LMX5::etr1-1 H20	LMX5::etr1-1 ACC	WT-TW	TUA1dEY TW	TUA1dEY+TUB15 TW	TUA1dY+TUB9 TW	Pde TW	OW:WT	OW:WT GA	OW:OE-ARK2	OW:OE-ARK2 GA	OW:miRNA-ARK2	OW:miRNA-ARK2 GA	OW 2hr	OW 8hr	OW 24hr	OW 48hr	OW 96hr	OW 336hr	Root CTR	Root LongCold	Root LongDrougt	Root LongHeat	Root LongSalt	Root ShortCold	Root ShortDrougt	Root ShortHeat	Root ShortSalt	Ptr root	Leaf CTR	Leaf LongCold	Leaf LongDrougt	Leaf LongHeat	Leaf LongSalt	Leaf ShortCold	Leaf ShortDrougt	Leaf ShortHeat	Leaf ShortSalt	Ptr leaf	Stem CTR	Stem LongCold	Stem LongDrougt	Stem LongHeat	Stem LongSalt	Stem ShortCold	Stem ShortDrougt	Stem ShortHeat	Stem ShortSalt	Ptr shoot	Ptr xylem	Ptr phloem	Ptr fiber	Ptr vessel	Ptr fiber vessel ray
AT5G59720		HSP18.2 HSP18.1...	heat shock protein 18.2 (.1)		Potri.010G195700 [exp]	0	1	Pt-HSP18.4
AT2G46240		ATBAG6, BAG6	ARABIDOPSIS THALIANA BCL-2-ASS...		Potri.002G166300 [exp]	1.41	0.9966
AT1G74310		HOT1, ATHSP101	heat shock protein 101 (.1)		Potri.015G056900 [exp]	3.16	0.9944	Pt-ATHSP101.1
AT3G12580		ATHSP70, HSP70	ARABIDOPSIS HEAT SHOCK PROTEIN...		Potri.001G042600 [exp]	3.87	0.9942	HSP70.9
AT5G15250		FTSH6, ATFTSH6	FTSH protease 6 (.1.2)		Potri.017G084000 [exp]	4.69	0.9852
					Potri.007G057050 [exp]	5.91	0.9485
AT3G12580		ATHSP70, HSP70	ARABIDOPSIS HEAT SHOCK PROTEIN...		Potri.001G042700 [exp]	5.91	0.9907	Pt-HSP70.10
AT2G29500			HSP20-like chaperones superfam...		Potri.009G049800 [exp]	5.91	0.9878	Pt-HSP17.9
AT1G69680			Mog1/PsbP/DUF1795-like photosy...		Potri.013G049900 [exp]	6.92	0.9612
AT4G18490			unknown protein		Potri.011G063500 [exp]	7.34	0.9705
AT5G02920			F-box/RNI-like superfamily pro...		Potri.017G146500 [exp]	7.34	0.9419

Compare expression of checked genes

Potri.010G195700 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.