Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser] Popgenie AspWood
Symbol	Pt-RPS28.1
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT5G64140 89 / 2e-25 RPS28 ribosomal protein S28 (.1) AT5G03850 89 / 2e-25 Nucleic acid-binding, OB-fold-like protein (.1) AT3G10090 89 / 2e-25 Nucleic acid-binding, OB-fold-like protein (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.008G013200 [exp] 102 / 1e-30 AT5G64140 90 / 5e-26 ribosomal protein S28 (.1) Potri.016G063100 [exp] 97 / 7e-29 AT5G64140 89 / 1e-25 ribosomal protein S28 (.1)
Flax homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10017293 [exp] 97 / 1e-27 AT3G10090 113 / 1e-33 Nucleic acid-binding, OB-fold-like protein (.1) Lus10016222 [exp] 94 / 2e-27 AT3G10090 111 / 3e-34 Nucleic acid-binding, OB-fold-like protein (.1) Lus10029320 [exp] 94 / 2e-27 AT3G10090 111 / 3e-34 Nucleic acid-binding, OB-fold-like protein (.1) Lus10013543 [exp] 98 / 3e-27 AT5G64140 114 / 4e-33 ribosomal protein S28 (.1)
PFAM info	Clan ID Clan name Pfam ID Pfam name Pfam description CL0021 [poplar] [flax] OB PF01200 [poplar] [flax] Ribosomal_S28e Ribosomal protein S28e
Representative CDS sequence Show only first row Show all	>Potri.010G245400.1 pacid=42798700 polypeptide=Potri.010G245400.1.p locus=Potri.010G245400 ID=Potri.010G245400.1.v4.1 annot-version=v4.1 ATGGATAGTCAAATTAAGCATGCTGTGGTGGTGAAAATTATGGGAAGGACTGGATCTCGAGGACAGGTTACTCAGGTTAGAGTCAAGTTTATTGATGACC AGAACCGTTTCATAATGAGGAACGTCAAGGGACCAGTTAGAGAAGGTGACATTCTTACCTTGCTTGAGTCTGAGAGAGAAGCTAGGAGACTCCGTTGA
AA sequence Show only first row Show all	>Potri.010G245400.1 pacid=42798700 polypeptide=Potri.010G245400.1.p locus=Potri.010G245400 ID=Potri.010G245400.1.v4.1 annot-version=v4.1 MDSQIKHAVVVKIMGRTGSRGQVTQVRVKFIDDQNRFIMRNVKGPVREGDILTLLESEREARRLR

---

DESeq2's median of ratios [POPLAR]

Mapped by: StringTie Salmon Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	NWA:WT	NWB:WT	NWA:OE-ARK2	NWB:OE-ARK2	NWA:miRNA-ARK2	NWB:miRNA-ARK2	NW 0hr	WT H20	WT-NW	TUA1dEY NW	TUA1dEY+TUB15 NW	TUA1dY+TUB9 NW	Pde NW	NWA:WT GA	NWBWT GA	TW:WT	TW:WT GA	NWA:OE-ARK2 GA	NWB:OE-ARK2 GA	TW:OE-ARK2	TW:OE-ARK2 GA	NWA:miRNA-ARK2 GA	NWB:miRNA-ARK2 GA	TW:miRNA-ARK2	TW:miRNA-ARK2 GA	TW 2hr	TW 8hr	TW 24hr	TW 48hr	TW 96hr	TW 336hr	WT ACC	35S::etr1-1 H20	35S::etr1-1 ACC	LMX5::etr1-1 H20	LMX5::etr1-1 ACC	WT-TW	TUA1dEY TW	TUA1dEY+TUB15 TW	TUA1dY+TUB9 TW	Pde TW	OW:WT	OW:WT GA	OW:OE-ARK2	OW:OE-ARK2 GA	OW:miRNA-ARK2	OW:miRNA-ARK2 GA	OW 2hr	OW 8hr	OW 24hr	OW 48hr	OW 96hr	OW 336hr	Root CTR	Root LongCold	Root LongDrougt	Root LongHeat	Root LongSalt	Root ShortCold	Root ShortDrougt	Root ShortHeat	Root ShortSalt	Ptr root	Leaf CTR	Leaf LongCold	Leaf LongDrougt	Leaf LongHeat	Leaf LongSalt	Leaf ShortCold	Leaf ShortDrougt	Leaf ShortHeat	Leaf ShortSalt	Ptr leaf	Stem CTR	Stem LongCold	Stem LongDrougt	Stem LongHeat	Stem LongSalt	Stem ShortCold	Stem ShortDrougt	Stem ShortHeat	Stem ShortSalt	Ptr shoot	Ptr xylem	Ptr phloem	Ptr fiber	Ptr vessel	Ptr fiber vessel ray
AT5G64140		RPS28	ribosomal protein S28 (.1)		Potri.010G245400 [exp]	0	1	Pt-RPS28.1
AT4G14320			Zinc-binding ribosomal protein...		Potri.010G251500 [exp]	3.16	0.8840
AT3G54560		HTA11	histone H2A 11 (.1)		Potri.005G216600 [exp]	4.12	0.8199	HTA905
AT4G36130			Ribosomal protein L2 family (....		Potri.007G013101 [exp]	4.12	0.8904
AT3G04400		EMB2171	embryo defective 2171, Ribosom...		Potri.010G066400 [exp]	5.29	0.8870	Pt-RPL23.6
AT5G02960			Ribosomal protein S12/S23 fami...		Potri.010G217100 [exp]	5.65	0.8503	RPS23.2
AT3G02430			Protein of unknown function (D...		Potri.013G116300 [exp]	7.34	0.7665
AT3G52580			Ribosomal protein S11 family p...		Potri.001G218700 [exp]	8.00	0.8859
AT3G16980		NRPE9A, NRPD9A,...	RNA polymerases M/15 Kd subuni...		Potri.008G106900 [exp]	8.36	0.8403
AT4G29735			unknown protein		Potri.006G146800 [exp]	9.48	0.8216
AT2G30410		TFCA, KIS	TUBULIN FOLDING FACTOR A, tubu...		Potri.013G071100 [exp]	10.19	0.8058	TFCFA,Pt-KIS.1

Compare expression of checked genes

Potri.010G245400 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.