Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser] Popgenie AspWood
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT2G24370 52 / 4e-09 Protein kinase protein with adenine nucleotide alpha hydrolases-like domain (.1) AT4G31230 51 / 1e-08 Protein kinase protein with adenine nucleotide alpha hydrolases-like domain (.1) AT5G26150 50 / 2e-08 protein kinase family protein (.1) AT1G78940 50 / 3e-08 Protein kinase protein with adenine nucleotide alpha hydrolases-like domain (.1.2) AT5G12000 48 / 2e-07 Protein kinase protein with adenine nucleotide alpha hydrolases-like domain (.1) AT1G16760 46 / 6e-07 Protein kinase protein with adenine nucleotide alpha hydrolases-like domain (.1) AT2G07020 45 / 1e-06 Protein kinase protein with adenine nucleotide alpha hydrolases-like domain (.1) AT5G35380 45 / 2e-06 Protein kinase protein with adenine nucleotide alpha hydrolases-like domain (.1) AT3G20200 39 / 0.0002 Protein kinase protein with adenine nucleotide alpha hydrolases-like domain (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.006G225300 [exp] 57 / 1e-10 AT5G12000 749 / 0.0 Protein kinase protein with adenine nucleotide alpha hydrolases-like domain (.1) Potri.018G061600 [exp] 56 / 2e-10 AT5G12000 714 / 0.0 Protein kinase protein with adenine nucleotide alpha hydrolases-like domain (.1) Potri.006G078500 [exp] 55 / 7e-10 AT2G24370 824 / 0.0 Protein kinase protein with adenine nucleotide alpha hydrolases-like domain (.1) Potri.018G002400 [exp] 51 / 1e-08 AT2G24370 956 / 0.0 Protein kinase protein with adenine nucleotide alpha hydrolases-like domain (.1) Potri.007G001900 [exp] 48 / 2e-07 AT1G78940 757 / 0.0 Protein kinase protein with adenine nucleotide alpha hydrolases-like domain (.1.2) Potri.004G170901 [exp] 44 / 3e-06 AT1G78940 584 / 0.0 Protein kinase protein with adenine nucleotide alpha hydrolases-like domain (.1.2) Potri.004G170742 [exp] 44 / 3e-06 AT1G78940 786 / 0.0 Protein kinase protein with adenine nucleotide alpha hydrolases-like domain (.1.2) Potri.014G001700 [exp] 44 / 4e-06 AT1G78940 783 / 0.0 Protein kinase protein with adenine nucleotide alpha hydrolases-like domain (.1.2) Potri.001G198300 [exp] 42 / 1e-05 AT5G12000 639 / 0.0 Protein kinase protein with adenine nucleotide alpha hydrolases-like domain (.1)
Flax homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10042205 [exp] 51 / 2e-08 AT1G16760 691 / 0.0 Protein kinase protein with adenine nucleotide alpha hydrolases-like domain (.1) Lus10027593 [exp] 49 / 6e-08 AT2G24370 665 / 0.0 Protein kinase protein with adenine nucleotide alpha hydrolases-like domain (.1) Lus10040573 [exp] 49 / 8e-08 AT2G24370 815 / 0.0 Protein kinase protein with adenine nucleotide alpha hydrolases-like domain (.1) Lus10021596 [exp] 49 / 8e-08 AT2G24370 828 / 0.0 Protein kinase protein with adenine nucleotide alpha hydrolases-like domain (.1) Lus10035712 [exp] 49 / 9e-08 AT1G16760 624 / 0.0 Protein kinase protein with adenine nucleotide alpha hydrolases-like domain (.1) Lus10033340 [exp] 49 / 9e-08 AT1G16760 800 / 0.0 Protein kinase protein with adenine nucleotide alpha hydrolases-like domain (.1) Lus10008542 [exp] 48 / 1e-07 AT2G24370 823 / 0.0 Protein kinase protein with adenine nucleotide alpha hydrolases-like domain (.1) Lus10008609 [exp] 48 / 2e-07 AT1G16760 417 / 3e-137 Protein kinase protein with adenine nucleotide alpha hydrolases-like domain (.1) Lus10037298 [exp] 47 / 3e-07 AT1G16760 820 / 0.0 Protein kinase protein with adenine nucleotide alpha hydrolases-like domain (.1) Lus10024212 [exp] 47 / 3e-07 AT2G24370 780 / 0.0 Protein kinase protein with adenine nucleotide alpha hydrolases-like domain (.1)
PFAM info
Representative CDS sequence Show only first row Show all	>Potri.011G008356.1 pacid=42780354 polypeptide=Potri.011G008356.1.p locus=Potri.011G008356 ID=Potri.011G008356.1.v4.1 annot-version=v4.1 ATGAGCAATTTAAATGCAGTCTGCTTAGAAGCTGAGATGAGAAGATGGAGGCTTAAGCTGAAGCAGACCATGGAAATGTACAGCAGTACAGCTTGCAAAG AAGCACTTTCTGCAAAAACGAAAGTAGTTACATTTCATCATCAACTGCACGAAAAGTTTGAAAGAAGTTCGCTGTCATTGAACTCAATCCTGCATTTGAA CATGGACTCAATTGGCTCAGGAAGGAACTTAACTGAAGATATCAACGTCTCACAATTGAAGATATCAACGTCTCCAAAGATTACCCCTGCGAAGTGCGGG CATCAAATCTAA
AA sequence Show only first row Show all	>Potri.011G008356.1 pacid=42780354 polypeptide=Potri.011G008356.1.p locus=Potri.011G008356 ID=Potri.011G008356.1.v4.1 annot-version=v4.1 MSNLNAVCLEAEMRRWRLKLKQTMEMYSSTACKEALSAKTKVVTFHHQLHEKFERSSLSLNSILHLNMDSIGSGRNLTEDINVSQLKISTSPKITPAKCG HQI

---

DESeq2's median of ratios [POPLAR]

Mapped by: StringTie Salmon Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	NWA:WT	NWB:WT	NWA:OE-ARK2	NWB:OE-ARK2	NWA:miRNA-ARK2	NWB:miRNA-ARK2	NW 0hr	WT H20	WT-NW	TUA1dEY NW	TUA1dEY+TUB15 NW	TUA1dY+TUB9 NW	Pde NW	NWA:WT GA	NWBWT GA	TW:WT	TW:WT GA	NWA:OE-ARK2 GA	NWB:OE-ARK2 GA	TW:OE-ARK2	TW:OE-ARK2 GA	NWA:miRNA-ARK2 GA	NWB:miRNA-ARK2 GA	TW:miRNA-ARK2	TW:miRNA-ARK2 GA	TW 2hr	TW 8hr	TW 24hr	TW 48hr	TW 96hr	TW 336hr	WT ACC	35S::etr1-1 H20	35S::etr1-1 ACC	LMX5::etr1-1 H20	LMX5::etr1-1 ACC	WT-TW	TUA1dEY TW	TUA1dEY+TUB15 TW	TUA1dY+TUB9 TW	Pde TW	OW:WT	OW:WT GA	OW:OE-ARK2	OW:OE-ARK2 GA	OW:miRNA-ARK2	OW:miRNA-ARK2 GA	OW 2hr	OW 8hr	OW 24hr	OW 48hr	OW 96hr	OW 336hr	Root CTR	Root LongCold	Root LongDrougt	Root LongHeat	Root LongSalt	Root ShortCold	Root ShortDrougt	Root ShortHeat	Root ShortSalt	Ptr root	Leaf CTR	Leaf LongCold	Leaf LongDrougt	Leaf LongHeat	Leaf LongSalt	Leaf ShortCold	Leaf ShortDrougt	Leaf ShortHeat	Leaf ShortSalt	Ptr leaf	Stem CTR	Stem LongCold	Stem LongDrougt	Stem LongHeat	Stem LongSalt	Stem ShortCold	Stem ShortDrougt	Stem ShortHeat	Stem ShortSalt	Ptr shoot	Ptr xylem	Ptr phloem	Ptr fiber	Ptr vessel	Ptr fiber vessel ray
AT2G24370			Protein kinase protein with ad...		Potri.011G008356 [exp]	0	1
					Potri.011G008676 [exp]	1.41	0.9210
AT1G31280		AGO2	argonaute 2, Argonaute family ...		Potri.015G117350 [exp]	1.73	0.8463
AT5G05390		LAC12	laccase 12 (.1)		Potri.008G073800 [exp]	4.00	0.7898	LAC90b
AT5G52300		LTI65, RD29B	RESPONSIVE TO DESSICATION 29B,...		Potri.015G143950 [exp]	4.24	0.8100
AT2G29120		ATGLR2.7	GLUTAMATE RECEPTOR 2.7, gluta...		Potri.018G013200 [exp]	4.24	0.7857
AT3G23200			Uncharacterised protein family...		Potri.010G073000 [exp]	11.83	0.7410
AT2G30720			Thioesterase/thiol ester dehyd...		Potri.017G009800 [exp]	18.73	0.6557
AT4G08330			unknown protein		Potri.005G178000 [exp]	19.97	0.7398
AT1G51660		ATMKK4, ATMEK4	ARABIDOPSIS THALIANA MITOGEN-A...		Potri.013G110450 [exp]	23.45	0.6931
AT2G40435			unknown protein		Potri.016G132600 [exp]	27.71	0.7494

Compare expression of checked genes

Potri.011G008356 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.