Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser] Popgenie AspWood
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT3G51590 54 / 2e-10 LTP12 lipid transfer protein 12 (.1) AT5G01870 49 / 2e-08 Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein (.1) AT2G15050 49 / 2e-08 LTP7, LTP lipid transfer protein 7, lipid transfer protein (.1.2.3) AT4G33355 44 / 2e-06 Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein (.1.2) AT5G59320 42 / 1e-05 LTP3 lipid transfer protein 3 (.1) AT5G59310 40 / 4e-05 LTP4 lipid transfer protein 4 (.1) AT3G08770 38 / 0.0002 LTP6 lipid transfer protein 6 (.1.2) AT2G18370 38 / 0.0003 Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein (.1) AT2G38530 37 / 0.0005 cdf3, LP2, LTP2 cell growth defect factor-3, lipid transfer protein 2 (.1) AT3G22600 38 / 0.0006 Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.011G021900 [exp] 100 / 3e-28 AT3G08770 60 / 8e-13 lipid transfer protein 6 (.1.2) Potri.016G135700 [exp] 51 / 3e-09 AT5G59310 92 / 3e-25 lipid transfer protein 4 (.1) Potri.016G135500 [exp] 50 / 5e-09 AT5G59320 94 / 8e-26 lipid transfer protein 3 (.1) Potri.016G135400 [exp] 50 / 1e-08 AT5G59320 109 / 3e-32 lipid transfer protein 3 (.1) Potri.001G232700 [exp] 47 / 2e-07 AT2G18370 93 / 1e-25 Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein (.1) Potri.001G232900 [exp] 46 / 3e-07 AT2G18370 100 / 3e-28 Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein (.1) Potri.006G108100 [exp] 45 / 4e-07 AT2G38540 121 / 6e-37 ARABIDOPSIS THALIANA LIPID TRANSFER PROTEIN 1, lipid transfer protein 1 (.1) Potri.004G086600 [exp] 45 / 1e-06 AT2G38540 122 / 3e-37 ARABIDOPSIS THALIANA LIPID TRANSFER PROTEIN 1, lipid transfer protein 1 (.1) Potri.014G046500 [exp] 43 / 3e-06 AT4G33355 76 / 6e-19 Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein (.1.2)
Flax homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10003884 [exp] 58 / 1e-11 AT4G33355 72 / 6e-17 Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein (.1.2) Lus10001829 [exp] 57 / 3e-11 AT4G33355 81 / 1e-20 Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein (.1.2) Lus10028055 [exp] 55 / 1e-10 AT5G59310 66 / 9e-15 lipid transfer protein 4 (.1) Lus10014167 [exp] 55 / 1e-10 AT5G59310 102 / 2e-29 lipid transfer protein 4 (.1) Lus10028002 [exp] 52 / 2e-09 AT5G59310 64 / 3e-14 lipid transfer protein 4 (.1) Lus10028003 [exp] 52 / 2e-09 AT5G59310 64 / 3e-14 lipid transfer protein 4 (.1) Lus10012384 [exp] 51 / 2e-09 AT5G59310 76 / 4e-19 lipid transfer protein 4 (.1) Lus10012383 [exp] 52 / 3e-09 AT5G59310 64 / 4e-14 lipid transfer protein 4 (.1) Lus10022745 [exp] 51 / 3e-09 AT5G59310 103 / 1e-29 lipid transfer protein 4 (.1) Lus10015279 [exp] 50 / 5e-09 AT5G59320 116 / 6e-35 lipid transfer protein 3 (.1)
PFAM info	Clan ID Clan name Pfam ID Pfam name Pfam description CL0482 [poplar] [flax] Prolamin PF00234 [poplar] [flax] Tryp_alpha_amyl Protease inhibitor/seed storage/LTP family
Representative CDS sequence Show only first row Show all	>Potri.011G022150.1 pacid=42780693 polypeptide=Potri.011G022150.1.p locus=Potri.011G022150 ID=Potri.011G022150.1.v4.1 annot-version=v4.1 ATGGGGTTGTATTCTGTTTTCTGGGCAGTGATTTTGCTTGCGAGTGCAAACTCTGTCCATGGCAGCGATGCATGCACAGGCTTGCCTGGATTGCTTAACT GCGCCCCGTTCTTGCTGGGTAGTGTCTCATCACCTGATGCTAAGTGTTGTAAATCTCTAAAATGGCTAAGTCAGCATGCTATCAACAGGGAAGACAAAAG GGAACTCTGTAAATGTTTAAAGATAGAAGATTTGAAGCACAAGGGCGTTATCCTCGATAGAGCCAAAGCACTCCCTCGCCTGTGCAAAGTCCAGCTCCCG GTGCCACTCATACCTGATAATATAGACTGTGACAAGATAAAAGTTGCTGATGCGGAGTAA
AA sequence Show only first row Show all	>Potri.011G022150.1 pacid=42780693 polypeptide=Potri.011G022150.1.p locus=Potri.011G022150 ID=Potri.011G022150.1.v4.1 annot-version=v4.1 MGLYSVFWAVILLASANSVHGSDACTGLPGLLNCAPFLLGSVSSPDAKCCKSLKWLSQHAINREDKRELCKCLKIEDLKHKGVILDRAKALPRLCKVQLP VPLIPDNIDCDKIKVADAE

---

DESeq2's median of ratios [POPLAR]

Mapped by: StringTie Salmon Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	NWA:WT	NWB:WT	NWA:OE-ARK2	NWB:OE-ARK2	NWA:miRNA-ARK2	NWB:miRNA-ARK2	NW 0hr	WT H20	WT-NW	TUA1dEY NW	TUA1dEY+TUB15 NW	TUA1dY+TUB9 NW	Pde NW	NWA:WT GA	NWBWT GA	TW:WT	TW:WT GA	NWA:OE-ARK2 GA	NWB:OE-ARK2 GA	TW:OE-ARK2	TW:OE-ARK2 GA	NWA:miRNA-ARK2 GA	NWB:miRNA-ARK2 GA	TW:miRNA-ARK2	TW:miRNA-ARK2 GA	TW 2hr	TW 8hr	TW 24hr	TW 48hr	TW 96hr	TW 336hr	WT ACC	35S::etr1-1 H20	35S::etr1-1 ACC	LMX5::etr1-1 H20	LMX5::etr1-1 ACC	WT-TW	TUA1dEY TW	TUA1dEY+TUB15 TW	TUA1dY+TUB9 TW	Pde TW	OW:WT	OW:WT GA	OW:OE-ARK2	OW:OE-ARK2 GA	OW:miRNA-ARK2	OW:miRNA-ARK2 GA	OW 2hr	OW 8hr	OW 24hr	OW 48hr	OW 96hr	OW 336hr	Root CTR	Root LongCold	Root LongDrougt	Root LongHeat	Root LongSalt	Root ShortCold	Root ShortDrougt	Root ShortHeat	Root ShortSalt	Ptr root	Leaf CTR	Leaf LongCold	Leaf LongDrougt	Leaf LongHeat	Leaf LongSalt	Leaf ShortCold	Leaf ShortDrougt	Leaf ShortHeat	Leaf ShortSalt	Ptr leaf	Stem CTR	Stem LongCold	Stem LongDrougt	Stem LongHeat	Stem LongSalt	Stem ShortCold	Stem ShortDrougt	Stem ShortHeat	Stem ShortSalt	Ptr shoot	Ptr xylem	Ptr phloem	Ptr fiber	Ptr vessel	Ptr fiber vessel ray
AT3G51590		LTP12	lipid transfer protein 12 (.1)		Potri.011G022150 [exp]	0	1
AT2G27250		AtCLV3, CLV3	CLAVATA3 (.1.2.3)		Potri.009G020300 [exp]	1.00	1.0000
AT4G38470		STY46	serine/threonine/tyrosine kina...		Potri.004G179457 [exp]	10.95	0.8142
					Potri.006G228650 [exp]	20.00	0.7934
AT1G78720			SecY protein transport family ...		Potri.011G114900 [exp]	21.90	0.7934
					Potri.012G134051 [exp]	22.80	0.7934
AT5G12460			Protein of unknown function (D...		Potri.001G256200 [exp]	25.29	0.7934
					Potri.003G054301 [exp]	26.83	0.7934
AT5G15948		CPuORF10	conserved peptide upstream ope...		Potri.017G108901 [exp]	28.98	0.7934
					Potri.011G074033 [exp]	29.66	0.7933
AT1G61330			FBD, F-box and Leucine Rich Re...		Potri.004G034500 [exp]	30.70	0.7782

Compare expression of checked genes

Potri.011G022150 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.