Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser] Popgenie AspWood
Symbol	Pt-SUBI.7
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT4G05050 452 / 2e-164 UBQ11 ubiquitin 11 (.1.2.3.4) AT4G02890 452 / 2e-164 UBQ14 Ubiquitin family protein (.1.2.3.4) AT4G05320 453 / 2e-163 UBQ10 polyubiquitin 10 (.1.2.3.4.5.6) AT5G03240 453 / 2e-163 UBQ3 polyubiquitin 3 (.1.2.3) AT5G20620 454 / 2e-162 UBQ4 ubiquitin 4 (.1) AT1G65350 442 / 9e-159 UBQ13 ubiquitin 13 (.1) AT1G55060 429 / 6e-155 UBQ12 ubiquitin 12 (.1) AT5G37640 424 / 1e-151 UBQ9 ubiquitin 9 (.1) AT3G09790 365 / 3e-124 UBQ8 ubiquitin 8 (.1) AT1G31340 247 / 4e-84 NEDD8, ATRUB1, RUB1 ARABIDOPSIS THALIANA RELATED TO UBIQUITIN 1, related to ubiquitin 1 (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.004G021500 [exp] 453 / 2e-163 AT4G02890 604 / 0.0 Ubiquitin family protein (.1.2.3.4) Potri.006G129600 [exp] 451 / 2e-162 AT5G20620 600 / 0.0 ubiquitin 4 (.1) Potri.017G036800 [exp] 453 / 3e-162 AT4G05320 753 / 0.0 polyubiquitin 10 (.1.2.3.4.5.6) Potri.001G418500 [exp] 453 / 3e-162 AT4G05320 753 / 0.0 polyubiquitin 10 (.1.2.3.4.5.6) Potri.001G263000 [exp] 453 / 3e-162 AT4G05320 752 / 0.0 polyubiquitin 10 (.1.2.3.4.5.6) Potri.007G123300 [exp] 453 / 3e-162 AT4G05320 753 / 0.0 polyubiquitin 10 (.1.2.3.4.5.6) Potri.017G135600 [exp] 447 / 4e-161 AT4G02890 597 / 0.0 Ubiquitin family protein (.1.2.3.4) Potri.011G134200 [exp] 454 / 1e-160 AT4G05320 900 / 0.0 polyubiquitin 10 (.1.2.3.4.5.6) Potri.004G174175 [exp] 321 / 1e-105 AT4G05320 638 / 0.0 polyubiquitin 10 (.1.2.3.4.5.6)
Flax homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10018367 [exp] 452 / 3e-164 AT4G05320 452 / 4e-164 polyubiquitin 10 (.1.2.3.4.5.6) Lus10008873 [exp] 157 / 5e-49 AT3G52590 261 / 5e-92 HAPLESS 4, EARLY-RESPONSIVE TO DEHYDRATION 16, EMBRYO DEFECTIVE 2167, ubiquitin extension protein 1 (.1) Lus10030894 [exp] 155 / 4e-48 AT2G47110 257 / 3e-89 ubiquitin 6 (.1.2) Lus10030595 [exp] 155 / 4e-48 AT2G47110 257 / 3e-89 ubiquitin 6 (.1.2) Lus10022411 [exp] 76 / 1e-15 AT5G24240 731 / 0.0 Phosphatidylinositol 3- and 4-kinase ;Ubiquitin family protein (.1) Lus10018104 [exp] 59 / 4e-10 AT5G24240 689 / 0.0 Phosphatidylinositol 3- and 4-kinase ;Ubiquitin family protein (.1) Lus10010493 [exp] 59 / 6e-10 AT4G12570 830 / 0.0 ubiquitin protein ligase 5 (.1) Lus10034563 [exp] 56 / 8e-09 AT5G42220 444 / 3e-148 Ubiquitin-like superfamily protein (.1) Lus10007641 [exp] 55 / 1e-08 AT4G05230 145 / 1e-42 Ubiquitin-like superfamily protein (.1) Lus10027323 [exp] 53 / 5e-08 AT4G12570 72 / 5e-14 ubiquitin protein ligase 5 (.1)
PFAM info	Clan ID Clan name Pfam ID Pfam name Pfam description CL0072 [poplar] [flax] Ubiquitin PF11976 [poplar] [flax] Rad60-SLD Ubiquitin-2 like Rad60 SUMO-like
Representative CDS sequence Show only first row Show all	>Potri.011G026600.1 pacid=42780903 polypeptide=Potri.011G026600.1.p locus=Potri.011G026600 ID=Potri.011G026600.1.v4.1 annot-version=v4.1 ATGCAGATCTTCGTGAAAACCCTCACCGGCAAGACCATCACTCTGGAGGTGGAGAGCAGCGACACCATCGACAACGTCAAGGCCAAGATTCAAGACAAGG AAGGCATCCCACCGGATCAACAGCGTCTAATATTCGCTGGAAAGCAGCTCGAAGATGGCCGAACTTTGGCCGATTACAATATTCAGAAGGAGAGCACCCT CCATCTTGTCCTCCGTCTCCGAGGAGGTATGCAGATATTCGTCAAGACCTTGACCGGGAAGACCATTACTCTCGAGGTCGAGAGCAGCGACACCATCGAC AACGTTAAGGCAAAAATTCAAGACAAGGAAGGAATCCCACCAGACCAACAACGTTTGATCTTCGCTGGGAAACAACTTGAGGATGGTCGGACTCTAGCTG ATTATAATATTCAGAAGGAGTCGACCCTTCATCTTGTGCTCAGGCTCCGTGGAGGGATGCAGATTTTTGTGAAGACCCTAACCGGAAAGACTATTACGCT GGAGGTGGAGAGCAGCGACACCATCGACAACGTCAAGGCGAAGATTCAGGACAAGGAGGGGATCCCACCGGACCAGCAAAGGCTGATCTTTGCTGGGAAG CAGTTGGAGGATGGAAGGACTTTGGCTGATTATAATATCCAGAAAGAGTCTACTCTTCACCTTGTCTTACGCCTTCGCGGTGGCATCTAA
AA sequence Show only first row Show all	>Potri.011G026600.1 pacid=42780903 polypeptide=Potri.011G026600.1.p locus=Potri.011G026600 ID=Potri.011G026600.1.v4.1 annot-version=v4.1 MQIFVKTLTGKTITLEVESSDTIDNVKAKIQDKEGIPPDQQRLIFAGKQLEDGRTLADYNIQKESTLHLVLRLRGGMQIFVKTLTGKTITLEVESSDTID NVKAKIQDKEGIPPDQQRLIFAGKQLEDGRTLADYNIQKESTLHLVLRLRGGMQIFVKTLTGKTITLEVESSDTIDNVKAKIQDKEGIPPDQQRLIFAGK QLEDGRTLADYNIQKESTLHLVLRLRGGI

---

DESeq2's median of ratios [POPLAR]

Mapped by: StringTie Salmon Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	NWA:WT	NWB:WT	NWA:OE-ARK2	NWB:OE-ARK2	NWA:miRNA-ARK2	NWB:miRNA-ARK2	NW 0hr	WT H20	WT-NW	TUA1dEY NW	TUA1dEY+TUB15 NW	TUA1dY+TUB9 NW	Pde NW	NWA:WT GA	NWBWT GA	TW:WT	TW:WT GA	NWA:OE-ARK2 GA	NWB:OE-ARK2 GA	TW:OE-ARK2	TW:OE-ARK2 GA	NWA:miRNA-ARK2 GA	NWB:miRNA-ARK2 GA	TW:miRNA-ARK2	TW:miRNA-ARK2 GA	TW 2hr	TW 8hr	TW 24hr	TW 48hr	TW 96hr	TW 336hr	WT ACC	35S::etr1-1 H20	35S::etr1-1 ACC	LMX5::etr1-1 H20	LMX5::etr1-1 ACC	WT-TW	TUA1dEY TW	TUA1dEY+TUB15 TW	TUA1dY+TUB9 TW	Pde TW	OW:WT	OW:WT GA	OW:OE-ARK2	OW:OE-ARK2 GA	OW:miRNA-ARK2	OW:miRNA-ARK2 GA	OW 2hr	OW 8hr	OW 24hr	OW 48hr	OW 96hr	OW 336hr	Root CTR	Root LongCold	Root LongDrougt	Root LongHeat	Root LongSalt	Root ShortCold	Root ShortDrougt	Root ShortHeat	Root ShortSalt	Ptr root	Leaf CTR	Leaf LongCold	Leaf LongDrougt	Leaf LongHeat	Leaf LongSalt	Leaf ShortCold	Leaf ShortDrougt	Leaf ShortHeat	Leaf ShortSalt	Ptr leaf	Stem CTR	Stem LongCold	Stem LongDrougt	Stem LongHeat	Stem LongSalt	Stem ShortCold	Stem ShortDrougt	Stem ShortHeat	Stem ShortSalt	Ptr shoot	Ptr xylem	Ptr phloem	Ptr fiber	Ptr vessel	Ptr fiber vessel ray
AT4G05050		UBQ11	ubiquitin 11 (.1.2.3.4)		Potri.011G026600 [exp]	0	1	Pt-SUBI.7
AT4G39910		ATUBP3	ubiquitin-specific protease 3 ...		Potri.007G093600 [exp]	3.16	0.7964	Pt-UBP3.1
AT2G46620			P-loop containing nucleoside t...		Potri.002G175600 [exp]	13.49	0.8057
AT4G10810			unknown protein		Potri.002G173700 [exp]	23.49	0.7962
AT1G80570			RNI-like superfamily protein (...		Potri.017G053400 [exp]	25.61	0.7807
AT2G21620		RD2	Adenine nucleotide alpha hydro...		Potri.009G117500 [exp]	47.91	0.7824	RD2.1
AT1G28710			Nucleotide-diphospho-sugar tra...		Potri.015G110600 [exp]	50.40	0.7302
AT1G35520	ARF	ARF15	auxin response factor 15 (.1)		Potri.012G012950 [exp]	96.14	0.7519
AT5G57900		SKIP1	SKP1 interacting partner 1 (.1...		Potri.018G104900 [exp]	115.02	0.7296	Pt-SKIP1.1
AT3G63000		NPL41	NPL4-like protein 1 (.1)		Potri.002G213600 [exp]	122.40	0.7179
AT5G61920			unknown protein		Potri.006G178100 [exp]	149.43	0.7206

Compare expression of checked genes

Potri.011G026600 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.