Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser] Popgenie AspWood
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT1G29750 44 / 7e-06 RKF1 receptor-like kinase in flowers 1 (.1.2) AT1G53430 42 / 2e-05 Leucine-rich repeat transmembrane protein kinase (.1.2) AT1G07650 40 / 0.0001 Leucine-rich repeat transmembrane protein kinase (.1.2) AT1G29720 38 / 0.0008 Leucine-rich repeat transmembrane protein kinase (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.011G072891 [exp] 149 / 1e-46 AT1G29750 154 / 4e-43 receptor-like kinase in flowers 1 (.1.2) Potri.011G072566 [exp] 81 / 5e-19 AT1G29750 1210 / 0.0 receptor-like kinase in flowers 1 (.1.2) Potri.004G063200 [exp] 44 / 6e-06 AT1G29750 1019 / 0.0 receptor-like kinase in flowers 1 (.1.2) Potri.011G072691 [exp] 42 / 2e-05 AT1G29750 514 / 2e-174 receptor-like kinase in flowers 1 (.1.2) Potri.011G072300 [exp] 42 / 2e-05 AT1G29750 1024 / 0.0 receptor-like kinase in flowers 1 (.1.2) Potri.004G135500 [exp] 40 / 0.0001 AT1G07650 1324 / 0.0 Leucine-rich repeat transmembrane protein kinase (.1.2) Potri.004G063500 [exp] 0 / 1 AT1G29750 1182 / 0.0 receptor-like kinase in flowers 1 (.1.2)
Flax homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10015239 [exp] 55 / 1e-09 AT1G29750 1189 / 0.0 receptor-like kinase in flowers 1 (.1.2) Lus10031374 [exp] 41 / 9e-05 AT1G07650 1221 / 0.0 Leucine-rich repeat transmembrane protein kinase (.1.2) Lus10010951 [exp] 39 / 0.0004 AT1G07650 979 / 0.0 Leucine-rich repeat transmembrane protein kinase (.1.2) Lus10005418 [exp] 0 / 1 AT1G29750 800 / 0.0 receptor-like kinase in flowers 1 (.1.2)
PFAM info
Representative CDS sequence Show only first row Show all	>Potri.011G072791.1 pacid=42781438 polypeptide=Potri.011G072791.1.p locus=Potri.011G072791 ID=Potri.011G072791.1.v4.1 annot-version=v4.1 ATGCAGTTCACTAAGAGCCACATCAGCACCCGAGTTGCTGGAACCATGTTAGTCACCACATATAACACCTTAGGCAGGCGTATTTTTGACATTTATGTTC AGGTAAGTAGTCACTCTAATGTGAAACTTACATTTTTTTTGAAGTTGGAAGCAAGGACTACTTTGTCACAGGAAAGATTGGTTCGGAAAGGTTTCAATAT TGAAGATGATGTTGGCAGTGCTGAAAAGCCTTTAGTGAAACAACTATTGAATGTCAATGTGACTAATAATAAGATGAGGTTGGCAGTGCTGAAAAGCCTG ATAGGGGAGTTTATGGTCCCATCATATCAGCCATCTCTGTATTTTCTGATTTGA
AA sequence Show only first row Show all	>Potri.011G072791.1 pacid=42781438 polypeptide=Potri.011G072791.1.p locus=Potri.011G072791 ID=Potri.011G072791.1.v4.1 annot-version=v4.1 MQFTKSHISTRVAGTMLVTTYNTLGRRIFDIYVQVSSHSNVKLTFFLKLEARTTLSQERLVRKGFNIEDDVGSAEKPLVKQLLNVNVTNNKMRLAVLKSL IGEFMVPSYQPSLYFLI

---

DESeq2's median of ratios [POPLAR]

Mapped by: StringTie Salmon Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	NWA:WT	NWB:WT	NWA:OE-ARK2	NWB:OE-ARK2	NWA:miRNA-ARK2	NWB:miRNA-ARK2	NW 0hr	WT H20	WT-NW	TUA1dEY NW	TUA1dEY+TUB15 NW	TUA1dY+TUB9 NW	Pde NW	NWA:WT GA	NWBWT GA	TW:WT	TW:WT GA	NWA:OE-ARK2 GA	NWB:OE-ARK2 GA	TW:OE-ARK2	TW:OE-ARK2 GA	NWA:miRNA-ARK2 GA	NWB:miRNA-ARK2 GA	TW:miRNA-ARK2	TW:miRNA-ARK2 GA	TW 2hr	TW 8hr	TW 24hr	TW 48hr	TW 96hr	TW 336hr	WT ACC	35S::etr1-1 H20	35S::etr1-1 ACC	LMX5::etr1-1 H20	LMX5::etr1-1 ACC	WT-TW	TUA1dEY TW	TUA1dEY+TUB15 TW	TUA1dY+TUB9 TW	Pde TW	OW:WT	OW:WT GA	OW:OE-ARK2	OW:OE-ARK2 GA	OW:miRNA-ARK2	OW:miRNA-ARK2 GA	OW 2hr	OW 8hr	OW 24hr	OW 48hr	OW 96hr	OW 336hr	Root CTR	Root LongCold	Root LongDrougt	Root LongHeat	Root LongSalt	Root ShortCold	Root ShortDrougt	Root ShortHeat	Root ShortSalt	Ptr root	Leaf CTR	Leaf LongCold	Leaf LongDrougt	Leaf LongHeat	Leaf LongSalt	Leaf ShortCold	Leaf ShortDrougt	Leaf ShortHeat	Leaf ShortSalt	Ptr leaf	Stem CTR	Stem LongCold	Stem LongDrougt	Stem LongHeat	Stem LongSalt	Stem ShortCold	Stem ShortDrougt	Stem ShortHeat	Stem ShortSalt	Ptr shoot	Ptr xylem	Ptr phloem	Ptr fiber	Ptr vessel	Ptr fiber vessel ray
AT1G53430			Leucine-rich repeat transmembr...		Potri.011G072791 [exp]	0	1
AT1G61010		CPSF73-I	cleavage and polyadenylation s...		Potri.017G076300 [exp]	46.81	0.7261
AT5G06710	HD	HAT14	homeobox from Arabidopsis thal...		Potri.016G058600 [exp]	63.79	0.7220
AT4G37210			Tetratricopeptide repeat (TPR)...		Potri.002G130800 [exp]	83.73	0.6595
AT2G01818			PLATZ transcription factor fam...		Potri.010G103500 [exp]	105.73	0.7040
					Potri.001G213100 [exp]	145.36	0.6767
AT3G22970			Protein of unknown function (D...		Potri.002G046300 [exp]	149.55	0.6457
AT1G03010			Phototropic-responsive NPH3 fa...		Potri.014G133500 [exp]	159.93	0.6669
					Potri.006G071700 [exp]	196.93	0.6549
AT1G15780			unknown protein		Potri.003G014000 [exp]	208.84	0.6548
AT4G33860			Glycosyl hydrolase family 10 p...		Potri.009G087700 [exp]	246.80	0.6395

Compare expression of checked genes

Potri.011G072791 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.