Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser] Popgenie AspWood
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT5G42570 140 / 4e-43 B-cell receptor-associated 31-like (.1) AT1G11905 123 / 3e-36 B-cell receptor-associated protein 31-like (.1.2) AT3G20450 121 / 3e-36 B-cell receptor-associated protein 31-like (.1) AT5G48660 100 / 5e-27 B-cell receptor-associated protein 31-like (.1) AT3G07190 92 / 6e-24 B-cell receptor-associated protein 31-like (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.011G007200 [exp] 142 / 1e-43 AT5G42570 278 / 1e-95 B-cell receptor-associated 31-like (.1) Potri.004G007900 [exp] 139 / 3e-42 AT5G42570 259 / 3e-88 B-cell receptor-associated 31-like (.1) Potri.014G154800 [exp] 114 / 8e-33 AT5G42570 152 / 2e-46 B-cell receptor-associated 31-like (.1) Potri.014G191500 [exp] 98 / 2e-26 AT5G48660 237 / 2e-79 B-cell receptor-associated protein 31-like (.1) Potri.002G245300 [exp] 97 / 1e-25 AT3G07190 239 / 3e-80 B-cell receptor-associated protein 31-like (.1)
Flax homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10030043 [exp] 148 / 3e-46 AT5G42570 241 / 1e-81 B-cell receptor-associated 31-like (.1) Lus10031546 [exp] 142 / 2e-43 AT5G42570 287 / 3e-99 B-cell receptor-associated 31-like (.1) Lus10035283 [exp] 138 / 2e-42 AT5G42570 244 / 9e-83 B-cell receptor-associated 31-like (.1) Lus10020025 [exp] 127 / 8e-38 AT1G11905 225 / 9e-75 B-cell receptor-associated protein 31-like (.1.2) Lus10015132 [exp] 122 / 1e-35 AT5G42570 258 / 7e-88 B-cell receptor-associated 31-like (.1) Lus10038188 [exp] 101 / 2e-27 AT3G07190 265 / 1e-90 B-cell receptor-associated protein 31-like (.1) Lus10011842 [exp] 98 / 3e-26 AT5G48660 270 / 1e-92 B-cell receptor-associated protein 31-like (.1) Lus10022777 [exp] 97 / 1e-25 AT5G48660 271 / 9e-93 B-cell receptor-associated protein 31-like (.1)
PFAM info
Representative CDS sequence Show only first row Show all	>Potri.011G089100.1 pacid=42781096 polypeptide=Potri.011G089100.1.p locus=Potri.011G089100 ID=Potri.011G089100.1.v4.1 annot-version=v4.1 ATGATCAATCTTCTGTTCACCGTAGTATTCACCGAAATGGCTTTGATCCTGATCCTTTTGTTCAGGACCCCTGTAAGGAAGCTAGTGATCATGGCGATTG ACCAGTTGAAGCAAGGGAAGGGTCCGTTGGTGGCGAAAACTGTGGCGACAACCTTGATTGTGGTGTTCACTTCCGTCTTGCACAACGCGCTGCAGATTAG GAAACGCTTGCTAGATGCCGGCGCCGTTAATTCTGCCGACGAGGTTCTTATGGTAGAACGCATCCTCGAAGCATCTCTTCTAGGATTTTCTCTGTTTCTG GCAATGATGATAGATAGACTACATTGCTATATCAAAGAACTGCTTCAGGTTAGAAATGAATTGGAAGCGGTGAAAAGATTAAACTAG
AA sequence Show only first row Show all	>Potri.011G089100.1 pacid=42781096 polypeptide=Potri.011G089100.1.p locus=Potri.011G089100 ID=Potri.011G089100.1.v4.1 annot-version=v4.1 MINLLFTVVFTEMALILILLFRTPVRKLVIMAIDQLKQGKGPLVAKTVATTLIVVFTSVLHNALQIRKRLLDAGAVNSADEVLMVERILEASLLGFSLFL AMMIDRLHCYIKELLQVRNELEAVKRLN

---

DESeq2's median of ratios [POPLAR]

Mapped by: StringTie Salmon Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	NWA:WT	NWB:WT	NWA:OE-ARK2	NWB:OE-ARK2	NWA:miRNA-ARK2	NWB:miRNA-ARK2	NW 0hr	WT H20	WT-NW	TUA1dEY NW	TUA1dEY+TUB15 NW	TUA1dY+TUB9 NW	Pde NW	NWA:WT GA	NWBWT GA	TW:WT	TW:WT GA	NWA:OE-ARK2 GA	NWB:OE-ARK2 GA	TW:OE-ARK2	TW:OE-ARK2 GA	NWA:miRNA-ARK2 GA	NWB:miRNA-ARK2 GA	TW:miRNA-ARK2	TW:miRNA-ARK2 GA	TW 2hr	TW 8hr	TW 24hr	TW 48hr	TW 96hr	TW 336hr	WT ACC	35S::etr1-1 H20	35S::etr1-1 ACC	LMX5::etr1-1 H20	LMX5::etr1-1 ACC	WT-TW	TUA1dEY TW	TUA1dEY+TUB15 TW	TUA1dY+TUB9 TW	Pde TW	OW:WT	OW:WT GA	OW:OE-ARK2	OW:OE-ARK2 GA	OW:miRNA-ARK2	OW:miRNA-ARK2 GA	OW 2hr	OW 8hr	OW 24hr	OW 48hr	OW 96hr	OW 336hr	Root CTR	Root LongCold	Root LongDrougt	Root LongHeat	Root LongSalt	Root ShortCold	Root ShortDrougt	Root ShortHeat	Root ShortSalt	Ptr root	Leaf CTR	Leaf LongCold	Leaf LongDrougt	Leaf LongHeat	Leaf LongSalt	Leaf ShortCold	Leaf ShortDrougt	Leaf ShortHeat	Leaf ShortSalt	Ptr leaf	Stem CTR	Stem LongCold	Stem LongDrougt	Stem LongHeat	Stem LongSalt	Stem ShortCold	Stem ShortDrougt	Stem ShortHeat	Stem ShortSalt	Ptr shoot	Ptr xylem	Ptr phloem	Ptr fiber	Ptr vessel	Ptr fiber vessel ray
AT5G42570			B-cell receptor-associated 31-...		Potri.011G089100 [exp]	0	1
AT2G01080			Late embryogenesis abundant (L...		Potri.001G163800 [exp]	1.73	0.9699
AT1G70280			NHL domain-containing protein ...		Potri.016G092200 [exp]	3.16	0.9578
AT5G04890		RTM2	RESTRICTED TEV MOVEMENT 2, HSP...		Potri.010G245600 [exp]	3.87	0.9602
AT5G11620			SWIM zinc finger family protei...		Potri.006G238000 [exp]	7.07	0.9451
AT1G76040		CPK29	calcium-dependent protein kina...		Potri.002G017000 [exp]	7.93	0.9532
AT3G50120			Plant protein of unknown funct...		Potri.003G159300 [exp]	7.93	0.9473
AT3G15800			Glycosyl hydrolase superfamily...		Potri.003G032600 [exp]	9.16	0.9594
AT5G64620		ATC/VIF2, C/VIF...	cell wall / vacuolar inhibitor...		Potri.008G013400 [exp]	9.59	0.9319
AT3G05620			Plant invertase/pectin methyle...		Potri.013G013200 [exp]	9.79	0.9439
AT5G20870			O-Glycosyl hydrolases family 1...		Potri.006G216700 [exp]	10.09	0.9538

Compare expression of checked genes

Potri.011G089100 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.