Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser] Popgenie AspWood
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT1G61360 68 / 2e-14 S-locus lectin protein kinase family protein (.1.2) AT4G21390 68 / 3e-14 B120 S-locus lectin protein kinase family protein (.1) AT4G27290 67 / 5e-14 S-locus lectin protein kinase family protein (.1) AT1G61550 61 / 7e-12 S-locus lectin protein kinase family protein (.1) AT1G61390 61 / 8e-12 S-locus lectin protein kinase family protein (.1.2) AT1G11280 61 / 1e-11 S-locus lectin protein kinase family protein (.1.2.3.4) AT1G61370 60 / 1e-11 S-locus lectin protein kinase family protein (.1) AT1G11340 57 / 2e-10 S-locus lectin protein kinase family protein (.1) AT1G61380 57 / 2e-10 SD1-29 S-domain-1 29 (.1) AT1G61610 56 / 5e-10 S-locus lectin protein kinase family protein (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.011G125401 [exp] 223 / 8e-70 AT4G27290 824 / 0.0 S-locus lectin protein kinase family protein (.1) Potri.011G125151 [exp] 159 / 2e-46 AT4G27290 757 / 0.0 S-locus lectin protein kinase family protein (.1) Potri.011G125301 [exp] 155 / 3e-45 AT4G27290 775 / 0.0 S-locus lectin protein kinase family protein (.1) Potri.011G125351 [exp] 152 / 3e-44 AT4G27290 748 / 0.0 S-locus lectin protein kinase family protein (.1) Potri.011G125101 [exp] 122 / 5e-37 AT4G27290 82 / 5e-19 S-locus lectin protein kinase family protein (.1) Potri.001G414077 [exp] 130 / 1e-36 AT4G27290 855 / 0.0 S-locus lectin protein kinase family protein (.1) Potri.011G125050 [exp] 112 / 5e-30 AT4G27290 870 / 0.0 S-locus lectin protein kinase family protein (.1) Potri.001G411700 [exp] 110 / 2e-29 AT4G27290 800 / 0.0 S-locus lectin protein kinase family protein (.1) Potri.001G414200 [exp] 103 / 5e-27 AT4G27290 805 / 0.0 S-locus lectin protein kinase family protein (.1)
Flax homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10038554 [exp] 100 / 9e-26 AT4G27290 776 / 0.0 S-locus lectin protein kinase family protein (.1) Lus10038557 [exp] 81 / 9e-19 AT4G27290 803 / 0.0 S-locus lectin protein kinase family protein (.1) Lus10014813 [exp] 71 / 3e-15 AT4G27290 805 / 0.0 S-locus lectin protein kinase family protein (.1) Lus10014812 [exp] 70 / 5e-15 AT4G27290 749 / 0.0 S-locus lectin protein kinase family protein (.1) Lus10039732 [exp] 64 / 7e-13 AT2G19130 647 / 0.0 S-locus lectin protein kinase family protein (.1) Lus10013910 [exp] 63 / 1e-12 AT1G11340 628 / 0.0 S-locus lectin protein kinase family protein (.1) Lus10038556 [exp] 63 / 2e-12 AT4G21380 769 / 0.0 receptor kinase 3 (.1) Lus10007611 [exp] 62 / 2e-12 AT1G11340 751 / 0.0 S-locus lectin protein kinase family protein (.1) Lus10037865 [exp] 62 / 3e-12 AT4G27300 804 / 0.0 S-locus lectin protein kinase family protein (.1) Lus10042266 [exp] 61 / 7e-12 AT2G19130 775 / 0.0 S-locus lectin protein kinase family protein (.1)
PFAM info
Representative CDS sequence Show only first row Show all	>Potri.011G125451.1 pacid=42782192 polypeptide=Potri.011G125451.1.p locus=Potri.011G125451 ID=Potri.011G125451.1.v4.1 annot-version=v4.1 ATGTTGTCGGGATTACTATCATTTCCTTCTCTCACAACAAGATTACCTGTCTCCAAGAGATCTGCAACTGAATCCTCTGCAGTTCTTGATGAATTCGATG ACCAAACAATATCATTTGTGCTACTGTACAGGACAAGTATCCCTTTGCTGCTTATATTCAGAGCCCCCAAAGTATTGGAAAGTGGAACTTCTCTGTTTGC TACCCATATAACTGTACGAGGAGACTTCTTATACCATATTCCCAAGAAACGTTTTGTTGAATTTCCAGGGCTGAAAAATCCTAGTTCAAATTTTCCCCCG GTTGAAAGGAGAGTTGCACCATCTCTTATGGATTGGCTTGGGTAG
AA sequence Show only first row Show all	>Potri.011G125451.1 pacid=42782192 polypeptide=Potri.011G125451.1.p locus=Potri.011G125451 ID=Potri.011G125451.1.v4.1 annot-version=v4.1 MLSGLLSFPSLTTRLPVSKRSATESSAVLDEFDDQTISFVLLYRTSIPLLLIFRAPKVLESGTSLFATHITVRGDFLYHIPKKRFVEFPGLKNPSSNFPP VERRVAPSLMDWLG

---

DESeq2's median of ratios [POPLAR]

Mapped by: StringTie Salmon Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	NWA:WT	NWB:WT	NWA:OE-ARK2	NWB:OE-ARK2	NWA:miRNA-ARK2	NWB:miRNA-ARK2	NW 0hr	WT H20	WT-NW	TUA1dEY NW	TUA1dEY+TUB15 NW	TUA1dY+TUB9 NW	Pde NW	NWA:WT GA	NWBWT GA	TW:WT	TW:WT GA	NWA:OE-ARK2 GA	NWB:OE-ARK2 GA	TW:OE-ARK2	TW:OE-ARK2 GA	NWA:miRNA-ARK2 GA	NWB:miRNA-ARK2 GA	TW:miRNA-ARK2	TW:miRNA-ARK2 GA	TW 2hr	TW 8hr	TW 24hr	TW 48hr	TW 96hr	TW 336hr	WT ACC	35S::etr1-1 H20	35S::etr1-1 ACC	LMX5::etr1-1 H20	LMX5::etr1-1 ACC	WT-TW	TUA1dEY TW	TUA1dEY+TUB15 TW	TUA1dY+TUB9 TW	Pde TW	OW:WT	OW:WT GA	OW:OE-ARK2	OW:OE-ARK2 GA	OW:miRNA-ARK2	OW:miRNA-ARK2 GA	OW 2hr	OW 8hr	OW 24hr	OW 48hr	OW 96hr	OW 336hr	Root CTR	Root LongCold	Root LongDrougt	Root LongHeat	Root LongSalt	Root ShortCold	Root ShortDrougt	Root ShortHeat	Root ShortSalt	Ptr root	Leaf CTR	Leaf LongCold	Leaf LongDrougt	Leaf LongHeat	Leaf LongSalt	Leaf ShortCold	Leaf ShortDrougt	Leaf ShortHeat	Leaf ShortSalt	Ptr leaf	Stem CTR	Stem LongCold	Stem LongDrougt	Stem LongHeat	Stem LongSalt	Stem ShortCold	Stem ShortDrougt	Stem ShortHeat	Stem ShortSalt	Ptr shoot	Ptr xylem	Ptr phloem	Ptr fiber	Ptr vessel	Ptr fiber vessel ray
AT4G27290			S-locus lectin protein kinase ...		Potri.011G125451 [exp]	0	1
					Potri.017G071950 [exp]	12.68	0.7606
AT4G21200		ATGA2OX8	ARABIDOPSIS THALIANA GIBBERELL...		Potri.004G022800 [exp]	14.69	0.7073
AT4G23990		ATCSLG3	ARABIDOPSIS THALIANA CELLULOSE...		Potri.014G156200 [exp]	19.62	0.6897
					Potri.001G399050 [exp]	19.79	0.7108
AT3G63095			Tetratricopeptide repeat (TPR)...		Potri.004G022700 [exp]	25.45	0.6795
					Potri.010G084201 [exp]	35.07	0.6518
AT1G78720			SecY protein transport family ...		Potri.011G114900 [exp]	37.78	0.6404
AT5G12460			Protein of unknown function (D...		Potri.001G256200 [exp]	40.39	0.6404
AT3G54450			Major facilitator superfamily ...		Potri.001G027100 [exp]	41.83	0.6565
					Potri.003G054301 [exp]	42.84	0.6404

Compare expression of checked genes

Potri.011G125451 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.