Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser] Popgenie AspWood
Symbol	SAUR5
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT3G12955 91 / 2e-24 SAUR-like auxin-responsive protein family (.1) AT5G20820 72 / 3e-17 SAUR-like auxin-responsive protein family (.1) AT1G72430 71 / 1e-16 SAUR-like auxin-responsive protein family (.1) AT1G17345 63 / 1e-13 SAUR-like auxin-responsive protein family (.1) AT5G50760 48 / 2e-07 SAUR-like auxin-responsive protein family (.1) AT5G20810 47 / 2e-07 SAUR-like auxin-responsive protein family (.1.2) AT5G66260 45 / 5e-07 SAUR-like auxin-responsive protein family (.1) AT3G43120 46 / 7e-07 SAUR-like auxin-responsive protein family (.1) AT1G56150 44 / 2e-06 SAUR-like auxin-responsive protein family (.1) AT3G12830 44 / 3e-06 SAUR-like auxin-responsive protein family (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.001G458000 [exp] 192 / 1e-64 AT3G12955 86 / 3e-22 SAUR-like auxin-responsive protein family (.1) Potri.006G137000 [exp] 77 / 3e-19 AT5G20820 135 / 3e-42 SAUR-like auxin-responsive protein family (.1) Potri.003G071000 [exp] 75 / 2e-18 AT1G72430 126 / 9e-39 SAUR-like auxin-responsive protein family (.1) Potri.001G164300 [exp] 57 / 2e-11 AT1G72430 108 / 2e-31 SAUR-like auxin-responsive protein family (.1) Potri.006G211000 [exp] 49 / 4e-08 AT2G36210 130 / 3e-40 SAUR-like auxin-responsive protein family (.1) Potri.004G164400 [exp] 45 / 7e-07 AT4G34760 182 / 4e-61 SAUR-like auxin-responsive protein family (.1) Potri.009G126000 [exp] 44 / 2e-06 AT4G34760 179 / 4e-60 SAUR-like auxin-responsive protein family (.1) Potri.004G164300 [exp] 43 / 5e-06 AT5G10990 170 / 3e-55 SAUR-like auxin-responsive protein family (.1) Potri.009G125900 [exp] 43 / 9e-06 AT5G10990 157 / 5e-50 SAUR-like auxin-responsive protein family (.1)
Flax homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10031790 [exp] 107 / 1e-30 AT3G12955 98 / 8e-27 SAUR-like auxin-responsive protein family (.1) Lus10037443 [exp] 61 / 1e-12 AT1G72430 114 / 1e-33 SAUR-like auxin-responsive protein family (.1) Lus10013181 [exp] 60 / 3e-12 AT1G72430 119 / 9e-36 SAUR-like auxin-responsive protein family (.1) Lus10042374 [exp] 44 / 3e-06 AT5G10990 125 / 8e-38 SAUR-like auxin-responsive protein family (.1) Lus10034507 [exp] 44 / 6e-06 AT1G75590 189 / 1e-62 SAUR-like auxin-responsive protein family (.1) Lus10017018 [exp] 43 / 7e-06 AT2G36210 124 / 3e-37 SAUR-like auxin-responsive protein family (.1) Lus10026297 [exp] 43 / 7e-06 AT5G10990 125 / 2e-37 SAUR-like auxin-responsive protein family (.1) Lus10021341 [exp] 43 / 8e-06 AT2G36210 123 / 4e-37 SAUR-like auxin-responsive protein family (.1) Lus10034888 [exp] 43 / 8e-06 AT5G20810 210 / 2e-70 SAUR-like auxin-responsive protein family (.1.2) Lus10024326 [exp] 42 / 1e-05 AT1G75580 166 / 2e-54 SAUR-like auxin-responsive protein family (.1)
PFAM info	Clan ID Clan name Pfam ID Pfam name Pfam description PF02519 [poplar] [flax] Auxin_inducible Auxin responsive protein
Representative CDS sequence Show only first row Show all	>Potri.011G143400.3 pacid=42781702 polypeptide=Potri.011G143400.3.p locus=Potri.011G143400 ID=Potri.011G143400.3.v4.1 annot-version=v4.1 ATGAAGAAGATCAACTTGATACTAAGGAAATGCAAGAGTTTGTCAAGGCAACTAGGGAGATCTTCATCTTATAGTAGCCTAAGGTCTAAGTCAACCAGGG AAGATTTATGGGGTGATCACAAGCAAGAAAATGAAAATCATGAAACAATATTTGTTGGAAGCACAAGAAAGAGGTATGTCATTAGCTCCAAGTATCTGAG CCATCCTCTGGTGAACGCTCTCATTGAGAAGTCAAGGCAAAAACCAGGAGAGGATAATATTTTGGTGGTGAAATGTGAGGTGGTCTTTTTTGACCACCTT TTATGGATGCTTGAAAATGCTGATCCAAATGCTAGTTTTGATTCTTTGGAAGAATTAGCTGATCTCTACATGTTCTAA
AA sequence Show only first row Show all	>Potri.011G143400.3 pacid=42781702 polypeptide=Potri.011G143400.3.p locus=Potri.011G143400 ID=Potri.011G143400.3.v4.1 annot-version=v4.1 MKKINLILRKCKSLSRQLGRSSSYSSLRSKSTREDLWGDHKQENENHETIFVGSTRKRYVISSKYLSHPLVNALIEKSRQKPGEDNILVVKCEVVFFDHL LWMLENADPNASFDSLEELADLYMF

---

DESeq2's median of ratios [POPLAR]

Mapped by: StringTie Salmon Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	NWA:WT	NWB:WT	NWA:OE-ARK2	NWB:OE-ARK2	NWA:miRNA-ARK2	NWB:miRNA-ARK2	NW 0hr	WT H20	WT-NW	TUA1dEY NW	TUA1dEY+TUB15 NW	TUA1dY+TUB9 NW	Pde NW	NWA:WT GA	NWBWT GA	TW:WT	TW:WT GA	NWA:OE-ARK2 GA	NWB:OE-ARK2 GA	TW:OE-ARK2	TW:OE-ARK2 GA	NWA:miRNA-ARK2 GA	NWB:miRNA-ARK2 GA	TW:miRNA-ARK2	TW:miRNA-ARK2 GA	TW 2hr	TW 8hr	TW 24hr	TW 48hr	TW 96hr	TW 336hr	WT ACC	35S::etr1-1 H20	35S::etr1-1 ACC	LMX5::etr1-1 H20	LMX5::etr1-1 ACC	WT-TW	TUA1dEY TW	TUA1dEY+TUB15 TW	TUA1dY+TUB9 TW	Pde TW	OW:WT	OW:WT GA	OW:OE-ARK2	OW:OE-ARK2 GA	OW:miRNA-ARK2	OW:miRNA-ARK2 GA	OW 2hr	OW 8hr	OW 24hr	OW 48hr	OW 96hr	OW 336hr	Root CTR	Root LongCold	Root LongDrougt	Root LongHeat	Root LongSalt	Root ShortCold	Root ShortDrougt	Root ShortHeat	Root ShortSalt	Ptr root	Leaf CTR	Leaf LongCold	Leaf LongDrougt	Leaf LongHeat	Leaf LongSalt	Leaf ShortCold	Leaf ShortDrougt	Leaf ShortHeat	Leaf ShortSalt	Ptr leaf	Stem CTR	Stem LongCold	Stem LongDrougt	Stem LongHeat	Stem LongSalt	Stem ShortCold	Stem ShortDrougt	Stem ShortHeat	Stem ShortSalt	Ptr shoot	Ptr xylem	Ptr phloem	Ptr fiber	Ptr vessel	Ptr fiber vessel ray
AT3G12955			SAUR-like auxin-responsive pro...		Potri.011G143400 [exp]	0	1	SAUR5
AT1G67410			Exostosin family protein (.1)		Potri.008G034500 [exp]	2.00	0.9192
AT3G08510		ATPLC2	phospholipase C 2 (.1.2.3)		Potri.008G068400 [exp]	3.46	0.9004	Pt-PLC1.2
AT1G71070			Core-2/I-branching beta-1,6-N-...		Potri.008G006500 [exp]	3.46	0.9223
AT4G13930		SHM4	serine hydroxymethyltransferas...		Potri.017G059300 [exp]	7.07	0.8909	SHM4.2
AT3G57690		AGP23, ATAGP23	ARABINOGALACTAN-PROTEIN 23, ar...		Potri.016G052001 [exp]	7.74	0.8754
AT1G22760		PAB3	poly(A) binding protein 3 (.1)		Potri.002G062700 [exp]	9.27	0.8472	PAB3.1
AT5G57830			Protein of unknown function, D...		Potri.006G181300 [exp]	9.53	0.8886
AT2G24540		AFR	ATTENUATED FAR-RED RESPONSE, G...		Potri.018G007100 [exp]	11.13	0.8159
AT3G56250			unknown protein		Potri.013G083700 [exp]	11.48	0.8781
AT1G79820		SGB1	SUPPRESSOR OF G PROTEIN BETA1,...		Potri.001G185300 [exp]	12.24	0.8795

Compare expression of checked genes

Potri.011G143400 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.