Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser] Popgenie AspWood
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT3G24770 54 / 2e-10 CLE41 CLAVATA3/ESR-RELATED 41 (.1) AT4G13195 44 / 1e-06 CLE44 CLAVATA3/ESR-RELATED 44 (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.002G241300 [exp] 96 / 1e-26 AT3G24770 52 / 1e-09 CLAVATA3/ESR-RELATED 41 (.1) Potri.003G156000 [exp] 39 / 0.0001 ND /
Flax homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10011868 [exp] 55 / 1e-10 AT3G24770 39 / 1e-04 CLAVATA3/ESR-RELATED 41 (.1)
PFAM info
Representative CDS sequence Show only first row Show all	>Potri.012G019400.1 pacid=42782898 polypeptide=Potri.012G019400.1.p locus=Potri.012G019400 ID=Potri.012G019400.1.v4.1 annot-version=v4.1 ATGGCAACACCAAAAACACAGTCAACTACAATCAGTGATCATCAAACCTGCACAAAAGCACACCGTTTCCTTTCATTACTTGCACTTCTTTTCATTTTTA TTTTACTCACTACCTCCACCAAAGTACCCATAAACCCAACAAATATGGCGGCATCGATTTCCATCAAAAGGCTTCTATTAGAATCCTCAGAACCAGCCTC TACTACCATGAACTTGCATCCAAAACAAACGCAAGACGCACGTACTTCTTCTTCTTCCACCTCATCATCAAAATCTACGCGTACCAAGTTTGGAGCTGCT GCTCATGAAGTTCCTAGCGGTCCAAACCCTATTTCAAACAGGTAA
AA sequence Show only first row Show all	>Potri.012G019400.1 pacid=42782898 polypeptide=Potri.012G019400.1.p locus=Potri.012G019400 ID=Potri.012G019400.1.v4.1 annot-version=v4.1 MATPKTQSTTISDHQTCTKAHRFLSLLALLFIFILLTTSTKVPINPTNMAASISIKRLLLESSEPASTTMNLHPKQTQDARTSSSSTSSSKSTRTKFGAA AHEVPSGPNPISNR

---

DESeq2's median of ratios [POPLAR]

Mapped by: StringTie Salmon Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	NWA:WT	NWB:WT	NWA:OE-ARK2	NWB:OE-ARK2	NWA:miRNA-ARK2	NWB:miRNA-ARK2	NW 0hr	WT H20	WT-NW	TUA1dEY NW	TUA1dEY+TUB15 NW	TUA1dY+TUB9 NW	Pde NW	NWA:WT GA	NWBWT GA	TW:WT	TW:WT GA	NWA:OE-ARK2 GA	NWB:OE-ARK2 GA	TW:OE-ARK2	TW:OE-ARK2 GA	NWA:miRNA-ARK2 GA	NWB:miRNA-ARK2 GA	TW:miRNA-ARK2	TW:miRNA-ARK2 GA	TW 2hr	TW 8hr	TW 24hr	TW 48hr	TW 96hr	TW 336hr	WT ACC	35S::etr1-1 H20	35S::etr1-1 ACC	LMX5::etr1-1 H20	LMX5::etr1-1 ACC	WT-TW	TUA1dEY TW	TUA1dEY+TUB15 TW	TUA1dY+TUB9 TW	Pde TW	OW:WT	OW:WT GA	OW:OE-ARK2	OW:OE-ARK2 GA	OW:miRNA-ARK2	OW:miRNA-ARK2 GA	OW 2hr	OW 8hr	OW 24hr	OW 48hr	OW 96hr	OW 336hr	Root CTR	Root LongCold	Root LongDrougt	Root LongHeat	Root LongSalt	Root ShortCold	Root ShortDrougt	Root ShortHeat	Root ShortSalt	Ptr root	Leaf CTR	Leaf LongCold	Leaf LongDrougt	Leaf LongHeat	Leaf LongSalt	Leaf ShortCold	Leaf ShortDrougt	Leaf ShortHeat	Leaf ShortSalt	Ptr leaf	Stem CTR	Stem LongCold	Stem LongDrougt	Stem LongHeat	Stem LongSalt	Stem ShortCold	Stem ShortDrougt	Stem ShortHeat	Stem ShortSalt	Ptr shoot	Ptr xylem	Ptr phloem	Ptr fiber	Ptr vessel	Ptr fiber vessel ray
AT3G24770		CLE41	CLAVATA3/ESR-RELATED 41 (.1)		Potri.012G019400 [exp]	0	1
AT5G45160			Root hair defective 3 GTP-bind...		Potri.012G116700 [exp]	3.00	0.8635
					Potri.006G225400 [exp]	6.85	0.8902
AT3G60720		PDLP8	plasmodesmata-located protein ...		Potri.014G067000 [exp]	7.48	0.8849
AT5G63710			Leucine-rich repeat protein ki...		Potri.001G306000 [exp]	9.48	0.8154
AT3G57670	C2H2ZnF	WIP2, NTT	WIP domain protein 2, NO TRANS...		Potri.003G205000 [exp]	10.00	0.8621
AT4G09890			Protein of unknown function (D...		Potri.002G065200 [exp]	14.83	0.7856
AT3G12090		TET6	tetraspanin6 (.1)		Potri.010G220300 [exp]	16.43	0.8552
AT3G24770		CLE41	CLAVATA3/ESR-RELATED 41 (.1)		Potri.002G241300 [exp]	17.20	0.8511
					Potri.015G025700 [exp]	20.78	0.7914
AT1G69970		CLE26	CLAVATA3/ESR-RELATED 26 (.1.2)		Potri.010G039800 [exp]	21.21	0.8582

Compare expression of checked genes

Potri.012G019400 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.