Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser] Popgenie AspWood
Symbol	Pt-UBQ1.2
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT3G52590 260 / 2e-91 HAP4, ERD16, UBQ1, EMB2167 HAPLESS 4, EARLY-RESPONSIVE TO DEHYDRATION 16, EMBRYO DEFECTIVE 2167, ubiquitin extension protein 1 (.1) AT2G36170 260 / 2e-91 Ubiquitin supergroup;Ribosomal protein L40e (.1) AT4G05050 157 / 3e-50 UBQ11 ubiquitin 11 (.1.2.3.4) AT2G35635 156 / 5e-50 UBQ7, RUB2 RELATED TO UBIQUITIN 2, ubiquitin 7 (.1) AT1G23410 156 / 6e-50 Ribosomal protein S27a / Ubiquitin family protein (.1) AT1G31340 156 / 6e-50 NEDD8, ATRUB1, RUB1 ARABIDOPSIS THALIANA RELATED TO UBIQUITIN 1, related to ubiquitin 1 (.1) AT3G62250 156 / 7e-50 UBQ5 ubiquitin 5 (.1) AT2G47110 156 / 7e-50 UBQ6 ubiquitin 6 (.1.2) AT4G02890 157 / 2e-49 UBQ14 Ubiquitin family protein (.1.2.3.4) AT1G55060 155 / 1e-48 UBQ12 ubiquitin 12 (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.016G077200 [exp] 263 / 7e-93 AT3G52590 260 / 2e-91 HAPLESS 4, EARLY-RESPONSIVE TO DEHYDRATION 16, EMBRYO DEFECTIVE 2167, ubiquitin extension protein 1 (.1) Potri.015G007100 [exp] 263 / 7e-93 AT3G52590 260 / 2e-91 HAPLESS 4, EARLY-RESPONSIVE TO DEHYDRATION 16, EMBRYO DEFECTIVE 2167, ubiquitin extension protein 1 (.1) Potri.004G194000 [exp] 210 / 1e-71 AT3G52590 210 / 3e-71 HAPLESS 4, EARLY-RESPONSIVE TO DEHYDRATION 16, EMBRYO DEFECTIVE 2167, ubiquitin extension protein 1 (.1) Potri.016G077000 [exp] 197 / 5e-67 AT3G52590 194 / 1e-65 HAPLESS 4, EARLY-RESPONSIVE TO DEHYDRATION 16, EMBRYO DEFECTIVE 2167, ubiquitin extension protein 1 (.1) Potri.002G062500 [exp] 156 / 7e-50 AT1G31340 296 / 9e-105 ARABIDOPSIS THALIANA RELATED TO UBIQUITIN 1, related to ubiquitin 1 (.1) Potri.011G026600 [exp] 158 / 1e-49 AT4G05050 452 / 3e-164 ubiquitin 11 (.1.2.3.4) Potri.014G115100 [exp] 155 / 1e-49 AT2G47110 255 / 2e-88 ubiquitin 6 (.1.2) Potri.015G111500 [exp] 155 / 1e-49 AT2G47110 257 / 3e-89 ubiquitin 6 (.1.2) Potri.002G190000 [exp] 155 / 1e-49 AT2G47110 257 / 3e-89 ubiquitin 6 (.1.2)
Flax homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10008873 [exp] 262 / 3e-92 AT3G52590 261 / 5e-92 HAPLESS 4, EARLY-RESPONSIVE TO DEHYDRATION 16, EMBRYO DEFECTIVE 2167, ubiquitin extension protein 1 (.1) Lus10030894 [exp] 156 / 6e-50 AT2G47110 257 / 3e-89 ubiquitin 6 (.1.2) Lus10030595 [exp] 156 / 6e-50 AT2G47110 257 / 3e-89 ubiquitin 6 (.1.2) Lus10018367 [exp] 157 / 3e-49 AT4G05320 452 / 4e-164 polyubiquitin 10 (.1.2.3.4.5.6) Lus10022695 [exp] 121 / 5e-37 AT2G36170 120 / 3e-37 Ubiquitin supergroup;Ribosomal protein L40e (.1) Lus10023236 [exp] 85 / 2e-22 AT3G52590 84 / 1e-22 HAPLESS 4, EARLY-RESPONSIVE TO DEHYDRATION 16, EMBRYO DEFECTIVE 2167, ubiquitin extension protein 1 (.1) Lus10014220 [exp] 74 / 2e-16 AT3G11510 236 / 4e-78 Ribosomal protein S11 family protein (.1) Lus10010493 [exp] 59 / 5e-11 AT4G12570 830 / 0.0 ubiquitin protein ligase 5 (.1) Lus10034563 [exp] 53 / 6e-09 AT5G42220 444 / 3e-148 Ubiquitin-like superfamily protein (.1) Lus10018538 [exp] 50 / 1e-08 AT2G35635 51 / 6e-09 RELATED TO UBIQUITIN 2, ubiquitin 7 (.1)
PFAM info	Clan ID Clan name Pfam ID Pfam name Pfam description CL0167 [poplar] [flax] Zn_Beta_Ribbon PF01020 [poplar] [flax] Ribosomal_L40e Ribosomal L40e family CL0072 [poplar] [flax] Ubiquitin PF11976 [poplar] [flax] Rad60-SLD Ubiquitin-2 like Rad60 SUMO-like
Representative CDS sequence Show only first row Show all	>Potri.012G024300.1 pacid=42784243 polypeptide=Potri.012G024300.1.p locus=Potri.012G024300 ID=Potri.012G024300.1.v4.1 annot-version=v4.1 ATGCAGATCTTTGTGAAAACCCTAACTGGCAAAACCATCACTCTTGAGGTCGAATCTAGTGATACTATTGACAATGTTAAAGCCAAAATCCAGGACAAGG AAGGGATTCCTCCTGACCAGCAGAGGCTGATCTTTGCTGGCAAGCAGCTGGAAGATGGACGTACCCTTGCTGATTACAATATCCAGAAGGAGTCAACACT TCATCTGGTTCTGAGGCTTCGTGGTGGAATTATCGAGCCATCTTTGATGGCATTGGCCAGGAAATATAACCAGGAAAAGATGATCTGCCGCAAATGCTAT GCACGCCTGCATCCTCGTGCTGTCAACTGCAGGAAGAAGAAGTGCGGCCACAGCAATCAGCTGAGGCCAAAGAAGAAGATTAAGTAG
AA sequence Show only first row Show all	>Potri.012G024300.1 pacid=42784243 polypeptide=Potri.012G024300.1.p locus=Potri.012G024300 ID=Potri.012G024300.1.v4.1 annot-version=v4.1 MQIFVKTLTGKTITLEVESSDTIDNVKAKIQDKEGIPPDQQRLIFAGKQLEDGRTLADYNIQKESTLHLVLRLRGGIIEPSLMALARKYNQEKMICRKCY ARLHPRAVNCRKKKCGHSNQLRPKKKIK

---

DESeq2's median of ratios [POPLAR]

Mapped by: StringTie Salmon Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	NWA:WT	NWB:WT	NWA:OE-ARK2	NWB:OE-ARK2	NWA:miRNA-ARK2	NWB:miRNA-ARK2	NW 0hr	WT H20	WT-NW	TUA1dEY NW	TUA1dEY+TUB15 NW	TUA1dY+TUB9 NW	Pde NW	NWA:WT GA	NWBWT GA	TW:WT	TW:WT GA	NWA:OE-ARK2 GA	NWB:OE-ARK2 GA	TW:OE-ARK2	TW:OE-ARK2 GA	NWA:miRNA-ARK2 GA	NWB:miRNA-ARK2 GA	TW:miRNA-ARK2	TW:miRNA-ARK2 GA	TW 2hr	TW 8hr	TW 24hr	TW 48hr	TW 96hr	TW 336hr	WT ACC	35S::etr1-1 H20	35S::etr1-1 ACC	LMX5::etr1-1 H20	LMX5::etr1-1 ACC	WT-TW	TUA1dEY TW	TUA1dEY+TUB15 TW	TUA1dY+TUB9 TW	Pde TW	OW:WT	OW:WT GA	OW:OE-ARK2	OW:OE-ARK2 GA	OW:miRNA-ARK2	OW:miRNA-ARK2 GA	OW 2hr	OW 8hr	OW 24hr	OW 48hr	OW 96hr	OW 336hr	Root CTR	Root LongCold	Root LongDrougt	Root LongHeat	Root LongSalt	Root ShortCold	Root ShortDrougt	Root ShortHeat	Root ShortSalt	Ptr root	Leaf CTR	Leaf LongCold	Leaf LongDrougt	Leaf LongHeat	Leaf LongSalt	Leaf ShortCold	Leaf ShortDrougt	Leaf ShortHeat	Leaf ShortSalt	Ptr leaf	Stem CTR	Stem LongCold	Stem LongDrougt	Stem LongHeat	Stem LongSalt	Stem ShortCold	Stem ShortDrougt	Stem ShortHeat	Stem ShortSalt	Ptr shoot	Ptr xylem	Ptr phloem	Ptr fiber	Ptr vessel	Ptr fiber vessel ray
AT3G52590		HAP4, ERD16, UB...	HAPLESS 4, EARLY-RESPONSIVE TO...		Potri.012G024300 [exp]	0	1	Pt-UBQ1.2
AT5G27700			Ribosomal protein S21e (.1)		Potri.005G026000 [exp]	1.00	0.9713
AT5G48760			Ribosomal protein L13 family p...		Potri.017G054600 [exp]	2.00	0.9616	RPL13.2
AT5G48760			Ribosomal protein L13 family p...		Potri.001G314500 [exp]	3.87	0.9615	RPL13.1
AT2G42740		RPL16A	ribosomal protein large subuni...		Potri.011G069200 [exp]	7.48	0.9554	L16.2
AT5G02960			Ribosomal protein S12/S23 fami...		Potri.016G085800 [exp]	9.48	0.9548	Pt-RPS23.5
AT5G61170			Ribosomal protein S19e family ...		Potri.004G118800 [exp]	9.53	0.9468	RPS19.1
AT1G70600			Ribosomal protein L18e/L15 sup...		Potri.006G202300 [exp]	10.19	0.9510	Pt-RPL27.4
AT1G36240			Ribosomal protein L7Ae/L30e/S1...		Potri.004G196500 [exp]	12.36	0.9448	Pt-RPL30.1
AT2G07340		PFD1	PREFOLDIN 1 (.1.2)		Potri.006G079700 [exp]	13.52	0.9184
AT4G15000			Ribosomal L27e protein family ...		Potri.016G019000 [exp]	13.85	0.9450	RPL27.1

Compare expression of checked genes

Potri.012G024300 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.