Potri.012G077101 [POPLAR]


External link
JGI Phytozome v13PopgenieAspWood                  
Symbol
Arabidopsis homologues
Locus ID BLAST score/e-value TF class Alias TAIR10 short description
AT5G62575 131 / 2e-41 SDH7B, SDH7 succinate dehydrogenase 7B, succinate dehydrogenase 7, unknown protein
AT3G47833 114 / 2e-34 SDH7A, SDH7 succinate dehydrogenase 7A, succinate dehydrogenase 7, unknown protein
Paralogs
Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description
Potri.015G072100 158 / 5e-52 AT5G62575 131 / 4e-41 succinate dehydrogenase 7B, succinate dehydrogenase 7, unknown protein
Flax homologues
Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description
Lus10042141 117 / 8e-35 AT5G62575 111 / 2e-32 succinate dehydrogenase 7B, succinate dehydrogenase 7, unknown protein
Lus10004231 86 / 1e-23 AT5G62575 80 / 3e-21 succinate dehydrogenase 7B, succinate dehydrogenase 7, unknown protein
Lus10034122 86 / 6e-23 AT5G62575 83 / 1e-21 succinate dehydrogenase 7B, succinate dehydrogenase 7, unknown protein
PFAM info
Representative CDS sequence
>Potri.012G077101.1 pacid=42783861 polypeptide=Potri.012G077101.1.p locus=Potri.012G077101 ID=Potri.012G077101.1.v4.1 annot-version=v4.1
ATGGGCTTGTTACTGAAGAATTACTCGACAATCACTTCTCACTACCGATCTCAATCTCAGACACAGGGCGCCTTCTCTCTTTCGCGTCGCGGATTCCATG
TTGAACCTGGTCCTCGCGAGCAAGCTCTCCTGGCCGAAGATCCATCTCTTAAGCGATTCAAATCACATAAGAAGAGTGTGTGGAGACTCAAAAGATTTGG
AGATGTTCTGACACTTGTTGTTGTAGCAGGCTGTTGCTATGAAATTTATGTCAAAACAGTAATGCGGGAAGAAGCTCGGAAACAGGCAAAGGAAAGTGCA
TGA
AA sequence
>Potri.012G077101.1 pacid=42783861 polypeptide=Potri.012G077101.1.p locus=Potri.012G077101 ID=Potri.012G077101.1.v4.1 annot-version=v4.1
MGLLLKNYSTITSHYRSQSQTQGAFSLSRRGFHVEPGPREQALLAEDPSLKRFKSHKKSVWRLKRFGDVLTLVVVAGCCYEIYVKTVMREEARKQAKESA

DESeq2's median of ratios [POPLAR]

Mapped by: Order by: Show schematic diagram

Coexpressed genes

Only top 10 genes are shown Show allDownload tab-delimited text
Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.
At best At TF class At alias At description Locus MR r Symbol NWA:WTNWB:WTNWA:OE-ARK2NWB:OE-ARK2NWA:miRNA-ARK2NWB:miRNA-ARK2NW 0hrWT H20WT-NWTUA1dEY NWTUA1dEY+TUB15 NWTUA1dY+TUB9 NWPde NWNWA:WT GANWBWT GATW:WTTW:WT GANWA:OE-ARK2 GANWB:OE-ARK2 GATW:OE-ARK2TW:OE-ARK2 GANWA:miRNA-ARK2 GANWB:miRNA-ARK2 GATW:miRNA-ARK2TW:miRNA-ARK2 GATW 2hrTW 8hrTW 24hrTW 48hrTW 96hrTW 336hrWT ACC35S::etr1-1 H2035S::etr1-1 ACCLMX5::etr1-1 H20LMX5::etr1-1 ACCWT-TWTUA1dEY TWTUA1dEY+TUB15 TWTUA1dY+TUB9 TWPde TWOW:WTOW:WT GAOW:OE-ARK2OW:OE-ARK2 GAOW:miRNA-ARK2OW:miRNA-ARK2 GAOW 2hrOW 8hrOW 24hrOW 48hrOW 96hrOW 336hrRoot CTRRoot LongColdRoot LongDrougtRoot LongHeatRoot LongSaltRoot ShortColdRoot ShortDrougtRoot ShortHeatRoot ShortSaltPtr rootLeaf CTRLeaf LongColdLeaf LongDrougtLeaf LongHeatLeaf LongSaltLeaf ShortColdLeaf ShortDrougtLeaf ShortHeatLeaf ShortSaltPtr leafStem CTRStem LongColdStem LongDrougtStem LongHeatStem LongSaltStem ShortColdStem ShortDrougtStem ShortHeatStem ShortSaltPtr shootPtr xylemPtr phloemPtr fiberPtr vesselPtr fiber vessel ray
AT5G62575 SDH7B, SDH7 succinate dehydrogenase 7B, su... Potri.012G077101 0 1
AT3G04400 EMB2171 embryo defective 2171, Ribosom... Potri.002G257500 3.74 0.8595
AT3G52580 Ribosomal protein S11 family p... Potri.001G218700 8.71 0.8539
AT3G57320 unknown protein Potri.006G046800 9.48 0.7868
AT5G18800 Cox19-like CHCH family protein... Potri.010G026000 10.00 0.8402
AT5G62200 Embryo-specific protein 3, (AT... Potri.001G193500 10.90 0.7388
AT5G20920 EIF2 BETA, EMB1... embryo defective 1401, eukaryo... Potri.019G131200 18.52 0.8330 EIF2.2
AT1G06200 Peptidase S24/S26A/S26B/S26C f... Potri.002G037900 20.97 0.7902
AT5G18420 unknown protein Potri.017G122600 26.26 0.7656
AT1G43190 PTB3 polypyrimidine tract-binding p... Potri.005G194700 29.15 0.7131
AT5G61170 Ribosomal protein S19e family ... Potri.004G118800 29.91 0.8376 RPS19.1

Potri.012G077101 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.