Potri.012G124500 [POPLAR]


External link
JGI Phytozome v13PopgenieAspWood                  
Symbol
Arabidopsis homologues
Locus ID BLAST score/e-value TF class Alias TAIR10 short description
AT1G31170 176 / 3e-58 ATSRX sulfiredoxin (.1.2.3.4)
Paralogs
Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description
Potri.015G124601 60 / 4e-13 AT1G31170 57 / 2e-12 sulfiredoxin (.1.2.3.4)
Flax homologues
Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description
Lus10036218 83 / 2e-21 AT1G31170 65 / 2e-14 sulfiredoxin (.1.2.3.4)
Lus10038354 82 / 3e-21 AT1G31170 67 / 2e-15 sulfiredoxin (.1.2.3.4)
PFAM info
Clan ID Clan name Pfam ID Pfam name Pfam description
CL0248 ParBc PF02195 ParBc ParB-like nuclease domain
Representative CDS sequence
>Potri.012G124500.1 pacid=42782637 polypeptide=Potri.012G124500.1.p locus=Potri.012G124500 ID=Potri.012G124500.1.v4.1 annot-version=v4.1
ATGGCAAATTTTGTTTTGAGACTGCCAGCAACCAGTTTCAGGGGCTTCTCTATTTCAGCTTCATCAAATGGGGCTGTCCCAGGGACAAGTACTAGAGCAC
AAAATGGAGGGCCAGTGATCTTAGAGTTGCCACTTGATAAGATAAGGAGGCCATTGATGAGAACCAGAGCTAATGATCCAAATAAGGTGAAAGAACTCAT
GGATAGCATCAAAGAAATTGGTCTTCAAGTACCTATTGATGTGCTTGAGGTCGATGGAGTTTACTATGGATTCTCGGGTTGCCATCGTTATGAAGCTCAC
CAGCGCCTTGGGCTCCCCACAATTCGTTGCAAAATTCGACGCGGAACAAAAGAAACTCTAAGGCATCACCTCCGCTGA
AA sequence
>Potri.012G124500.1 pacid=42782637 polypeptide=Potri.012G124500.1.p locus=Potri.012G124500 ID=Potri.012G124500.1.v4.1 annot-version=v4.1
MANFVLRLPATSFRGFSISASSNGAVPGTSTRAQNGGPVILELPLDKIRRPLMRTRANDPNKVKELMDSIKEIGLQVPIDVLEVDGVYYGFSGCHRYEAH
QRLGLPTIRCKIRRGTKETLRHHLR

DESeq2's median of ratios [POPLAR]

Mapped by: Order by: Show schematic diagram

Coexpressed genes

Only top 10 genes are shown Show allDownload tab-delimited text
Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.
At best At TF class At alias At description Locus MR r Symbol NWA:WTNWB:WTNWA:OE-ARK2NWB:OE-ARK2NWA:miRNA-ARK2NWB:miRNA-ARK2NW 0hrWT H20WT-NWTUA1dEY NWTUA1dEY+TUB15 NWTUA1dY+TUB9 NWPde NWNWA:WT GANWBWT GATW:WTTW:WT GANWA:OE-ARK2 GANWB:OE-ARK2 GATW:OE-ARK2TW:OE-ARK2 GANWA:miRNA-ARK2 GANWB:miRNA-ARK2 GATW:miRNA-ARK2TW:miRNA-ARK2 GATW 2hrTW 8hrTW 24hrTW 48hrTW 96hrTW 336hrWT ACC35S::etr1-1 H2035S::etr1-1 ACCLMX5::etr1-1 H20LMX5::etr1-1 ACCWT-TWTUA1dEY TWTUA1dEY+TUB15 TWTUA1dY+TUB9 TWPde TWOW:WTOW:WT GAOW:OE-ARK2OW:OE-ARK2 GAOW:miRNA-ARK2OW:miRNA-ARK2 GAOW 2hrOW 8hrOW 24hrOW 48hrOW 96hrOW 336hrRoot CTRRoot LongColdRoot LongDrougtRoot LongHeatRoot LongSaltRoot ShortColdRoot ShortDrougtRoot ShortHeatRoot ShortSaltPtr rootLeaf CTRLeaf LongColdLeaf LongDrougtLeaf LongHeatLeaf LongSaltLeaf ShortColdLeaf ShortDrougtLeaf ShortHeatLeaf ShortSaltPtr leafStem CTRStem LongColdStem LongDrougtStem LongHeatStem LongSaltStem ShortColdStem ShortDrougtStem ShortHeatStem ShortSaltPtr shootPtr xylemPtr phloemPtr fiberPtr vesselPtr fiber vessel ray
AT1G31170 ATSRX sulfiredoxin (.1.2.3.4) Potri.012G124500 0 1
AT1G52590 Putative thiol-disulphide oxid... Potri.008G213200 1.41 0.9365
AT3G56630 CYP94D2 "cytochrome P450, family 94, s... Potri.016G031700 1.41 0.9428 Pt-CYP94.6
AT1G77090 Mog1/PsbP/DUF1795-like photosy... Potri.002G072400 3.46 0.9200
AT4G38460 GGR geranylgeranyl reductase (.1) Potri.004G179628 4.00 0.9120
AT2G18630 Protein of unknown function (D... Potri.005G127300 6.85 0.8783
AT3G56630 CYP94D2 "cytochrome P450, family 94, s... Potri.016G031800 14.07 0.9157
AT4G21210 ATRP1 PPDK regulatory protein (.1.2) Potri.004G022900 14.28 0.8771
AT5G20060 alpha/beta-Hydrolases superfam... Potri.018G070700 17.54 0.8810
AT2G39000 Acyl-CoA N-acyltransferases (N... Potri.008G039300 22.18 0.9187
AT3G55250 PDE329 PIGMENT DEFECTIVE 329, unknown... Potri.017G073000 22.69 0.9179

Potri.012G124500 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.