Potri.013G005750 [POPLAR]


External link
JGI Phytozome v13PopgenieAspWood                  
Symbol
Arabidopsis homologues

No hit found

Paralogs
Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description
Flax homologues

No hit found

PFAM info
Representative CDS sequence
>Potri.013G005750.1 pacid=42812183 polypeptide=Potri.013G005750.1.p locus=Potri.013G005750 ID=Potri.013G005750.1.v4.1 annot-version=v4.1
ATGAGTGCCATTACATTTGTAGCTTCTGTTACTATTCTCTTGGTAGCCTCTGTAATCATCTTCCCCTCTGATGGAGTCACTGAAGATATTCTGGCTGCCA
TTTGCTCCCAAACTCAAAATCAAGAAACTTGTGAGGCCATTTTAGAGAGTGATCCGCGTACCAGCTCAGCTGACCTCCCTCTACTGTCTCTAATATCTCT
CGAGCTTTTATCGAAACAAGCTGATAAAAATCACAACAGTTTCGTGATAATTCTACAGATCCGGATTTGA
AA sequence
>Potri.013G005750.1 pacid=42812183 polypeptide=Potri.013G005750.1.p locus=Potri.013G005750 ID=Potri.013G005750.1.v4.1 annot-version=v4.1
MSAITFVASVTILLVASVIIFPSDGVTEDILAAICSQTQNQETCEAILESDPRTSSADLPLLSLISLELLSKQADKNHNSFVIILQIRI

DESeq2's median of ratios [POPLAR]

Mapped by: Order by: Show schematic diagram

Coexpressed genes

Only top 10 genes are shown Show allDownload tab-delimited text
Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.
At best At TF class At alias At description Locus MR r Symbol NWA:WTNWB:WTNWA:OE-ARK2NWB:OE-ARK2NWA:miRNA-ARK2NWB:miRNA-ARK2NW 0hrWT H20WT-NWTUA1dEY NWTUA1dEY+TUB15 NWTUA1dY+TUB9 NWPde NWNWA:WT GANWBWT GATW:WTTW:WT GANWA:OE-ARK2 GANWB:OE-ARK2 GATW:OE-ARK2TW:OE-ARK2 GANWA:miRNA-ARK2 GANWB:miRNA-ARK2 GATW:miRNA-ARK2TW:miRNA-ARK2 GATW 2hrTW 8hrTW 24hrTW 48hrTW 96hrTW 336hrWT ACC35S::etr1-1 H2035S::etr1-1 ACCLMX5::etr1-1 H20LMX5::etr1-1 ACCWT-TWTUA1dEY TWTUA1dEY+TUB15 TWTUA1dY+TUB9 TWPde TWOW:WTOW:WT GAOW:OE-ARK2OW:OE-ARK2 GAOW:miRNA-ARK2OW:miRNA-ARK2 GAOW 2hrOW 8hrOW 24hrOW 48hrOW 96hrOW 336hrRoot CTRRoot LongColdRoot LongDrougtRoot LongHeatRoot LongSaltRoot ShortColdRoot ShortDrougtRoot ShortHeatRoot ShortSaltPtr rootLeaf CTRLeaf LongColdLeaf LongDrougtLeaf LongHeatLeaf LongSaltLeaf ShortColdLeaf ShortDrougtLeaf ShortHeatLeaf ShortSaltPtr leafStem CTRStem LongColdStem LongDrougtStem LongHeatStem LongSaltStem ShortColdStem ShortDrougtStem ShortHeatStem ShortSaltPtr shootPtr xylemPtr phloemPtr fiberPtr vesselPtr fiber vessel ray
Potri.013G005750 0 1
AT4G34780 SAUR-like auxin-responsive pro... Potri.017G052501 30.85 0.6225
AT3G06240 F-box family protein (.1) Potri.008G199601 35.24 0.5481
AT5G02740 Ribosomal protein S24e family ... Potri.012G089800 59.32 0.5962
AT5G47530 Auxin-responsive family protei... Potri.019G096300 60.21 0.5388
Potri.011G051712 64.48 0.6029
AT4G34210 ASK11 SKP1-like 11 (.1) Potri.012G085200 65.40 0.6241
AT4G24570 DIC2 dicarboxylate carrier 2 (.1) Potri.017G047800 69.84 0.6413
AT3G06260 GolS9, GATL4 galactinol synthase 9, galactu... Potri.010G242300 78.84 0.6201
AT5G38200 Class I glutamine amidotransfe... Potri.010G120600 84.24 0.6186
AT3G24255 RNA-directed DNA polymerase (r... Potri.010G000101 84.63 0.6254

Potri.013G005750 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.