Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser] Popgenie AspWood
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT5G44870 43 / 4e-07 TTR1, LAZ5 tolerance to Tobacco ringspot virus 1, LAZARUS 5, Disease resistance protein (TIR-NBS-LRR class) family (.1) AT4G16990 43 / 5e-07 RLM3 RESISTANCE TO LEPTOSPHAERIA MACULANS 3, disease resistance protein (TIR-NBS class), putative AT5G49140 42 / 5e-07 Disease resistance protein (TIR-NBS-LRR class) family (.1) AT5G58120 42 / 6e-07 Disease resistance protein (TIR-NBS-LRR class) family (.1) AT4G11170 42 / 8e-07 Disease resistance protein (TIR-NBS-LRR class) family (.1) AT5G11250 42 / 9e-07 Disease resistance protein (TIR-NBS-LRR class) (.1) AT1G56540 42 / 9e-07 Disease resistance protein (TIR-NBS-LRR class) family (.1) AT1G64070 42 / 1e-06 RLM1 RESISTANCE TO LEPTOSPHAERIA MACULANS 1, Disease resistance protein (TIR-NBS-LRR class) family (.1) AT4G16860 41 / 2e-06 RPP5, RPP4 recognition of peronospora parasitica 4, Disease resistance protein (TIR-NBS-LRR class) family (.1) AT5G46450 41 / 2e-06 Disease resistance protein (TIR-NBS-LRR class) family (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.017G010800 [exp] 57 / 3e-12 AT5G17680 592 / 0.0 disease resistance protein (TIR-NBS-LRR class), putative (.1) Potri.019G068300 [exp] 50 / 1e-09 AT5G17680 580 / 0.0 disease resistance protein (TIR-NBS-LRR class), putative (.1) Potri.019G098600 [exp] 48 / 6e-09 AT2G20142 138 / 4e-40 Toll-Interleukin-Resistance (TIR) domain family protein (.1) Potri.019G098900 [exp] 47 / 1e-08 AT5G17680 477 / 6e-148 disease resistance protein (TIR-NBS-LRR class), putative (.1) Potri.019G003285 [exp] 47 / 1e-08 AT5G36930 640 / 0.0 Disease resistance protein (TIR-NBS-LRR class) family (.1), Disease resistance protein (TIR-NBS-LRR class) family (.2) Potri.019G070651 [exp] 47 / 1e-08 AT5G17680 630 / 0.0 disease resistance protein (TIR-NBS-LRR class), putative (.1) Potri.019G069500 [exp] 47 / 1e-08 AT5G17680 711 / 0.0 disease resistance protein (TIR-NBS-LRR class), putative (.1) Potri.019G070700 [exp] 47 / 1e-08 AT5G17680 722 / 0.0 disease resistance protein (TIR-NBS-LRR class), putative (.1) Potri.019G070436 [exp] 47 / 1e-08 AT2G20142 160 / 7e-49 Toll-Interleukin-Resistance (TIR) domain family protein (.1)
Flax homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10014829 [exp] 46 / 3e-08 AT5G17680 441 / 1e-136 disease resistance protein (TIR-NBS-LRR class), putative (.1) Lus10029722 [exp] 44 / 1e-07 AT5G17680 608 / 0.0 disease resistance protein (TIR-NBS-LRR class), putative (.1) Lus10005174 [exp] 43 / 1e-07 AT5G17680 47 / 3e-07 disease resistance protein (TIR-NBS-LRR class), putative (.1) Lus10042752 [exp] 43 / 2e-07 AT4G16990 145 / 5e-41 RESISTANCE TO LEPTOSPHAERIA MACULANS 3, disease resistance protein (TIR-NBS class), putative Lus10041606 [exp] 44 / 3e-07 AT5G36930 140 / 5e-37 Disease resistance protein (TIR-NBS-LRR class) family (.1), Disease resistance protein (TIR-NBS-LRR class) family (.2) Lus10026845 [exp] 44 / 3e-07 AT5G36930 145 / 8e-39 Disease resistance protein (TIR-NBS-LRR class) family (.1), Disease resistance protein (TIR-NBS-LRR class) family (.2) Lus10029810 [exp] 42 / 3e-07 AT4G12010 109 / 4e-29 Disease resistance protein (TIR-NBS-LRR class) family (.1) Lus10026201 [exp] 43 / 4e-07 AT5G17680 511 / 1e-160 disease resistance protein (TIR-NBS-LRR class), putative (.1) Lus10028343 [exp] 43 / 5e-07 AT3G44670 147 / 4e-40 Disease resistance protein (TIR-NBS-LRR class) family (.1), Disease resistance protein (TIR-NBS-LRR class) family (.2) Lus10041060 [exp] 42 / 7e-07 AT5G17680 641 / 0.0 disease resistance protein (TIR-NBS-LRR class), putative (.1)
PFAM info	Clan ID Clan name Pfam ID Pfam name Pfam description CL0173 [poplar] [flax] STIR PF01582 [poplar] [flax] TIR TIR domain
Representative CDS sequence Show only first row Show all	>Potri.013G085201.1 pacid=42812423 polypeptide=Potri.013G085201.1.p locus=Potri.013G085201 ID=Potri.013G085201.1.v4.1 annot-version=v4.1 ATGCTCTCTGTTATCATTTTTTCCCAAAACTATGCATCTTCCAAATGGTGCTTAGATGAGCTATTGAAGATTCTTGAAAGCTGA
AA sequence Show only first row Show all	>Potri.013G085201.1 pacid=42812423 polypeptide=Potri.013G085201.1.p locus=Potri.013G085201 ID=Potri.013G085201.1.v4.1 annot-version=v4.1 MLSVIIFSQNYASSKWCLDELLKILES

---

DESeq2's median of ratios [POPLAR]

Mapped by: StringTie Salmon Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	NWA:WT	NWB:WT	NWA:OE-ARK2	NWB:OE-ARK2	NWA:miRNA-ARK2	NWB:miRNA-ARK2	NW 0hr	WT H20	WT-NW	TUA1dEY NW	TUA1dEY+TUB15 NW	TUA1dY+TUB9 NW	Pde NW	NWA:WT GA	NWBWT GA	TW:WT	TW:WT GA	NWA:OE-ARK2 GA	NWB:OE-ARK2 GA	TW:OE-ARK2	TW:OE-ARK2 GA	NWA:miRNA-ARK2 GA	NWB:miRNA-ARK2 GA	TW:miRNA-ARK2	TW:miRNA-ARK2 GA	TW 2hr	TW 8hr	TW 24hr	TW 48hr	TW 96hr	TW 336hr	WT ACC	35S::etr1-1 H20	35S::etr1-1 ACC	LMX5::etr1-1 H20	LMX5::etr1-1 ACC	WT-TW	TUA1dEY TW	TUA1dEY+TUB15 TW	TUA1dY+TUB9 TW	Pde TW	OW:WT	OW:WT GA	OW:OE-ARK2	OW:OE-ARK2 GA	OW:miRNA-ARK2	OW:miRNA-ARK2 GA	OW 2hr	OW 8hr	OW 24hr	OW 48hr	OW 96hr	OW 336hr	Root CTR	Root LongCold	Root LongDrougt	Root LongHeat	Root LongSalt	Root ShortCold	Root ShortDrougt	Root ShortHeat	Root ShortSalt	Ptr root	Leaf CTR	Leaf LongCold	Leaf LongDrougt	Leaf LongHeat	Leaf LongSalt	Leaf ShortCold	Leaf ShortDrougt	Leaf ShortHeat	Leaf ShortSalt	Ptr leaf	Stem CTR	Stem LongCold	Stem LongDrougt	Stem LongHeat	Stem LongSalt	Stem ShortCold	Stem ShortDrougt	Stem ShortHeat	Stem ShortSalt	Ptr shoot	Ptr xylem	Ptr phloem	Ptr fiber	Ptr vessel	Ptr fiber vessel ray
AT4G16990		RLM3	RESISTANCE TO LEPTOSPHAERIA MA...		Potri.013G085201 [exp]	0	1
AT5G20900	ZIM	TIFY3B, JAZ12	jasmonate-zim-domain protein 1...		Potri.006G217200 [exp]	1.41	0.8196
AT5G35110			unknown protein		Potri.018G113700 [exp]	4.47	0.7622
AT3G47370			Ribosomal protein S10p/S20e fa...		Potri.002G116900 [exp]	5.47	0.7534
AT4G27280			Calcium-binding EF-hand family...		Potri.011G039600 [exp]	5.65	0.7399
AT2G45760		BAL, BAP2	BON ASSOCIATION PROTEIN 1-LIKE...		Potri.001G108300 [exp]	9.48	0.7671
AT1G07985			Expressed protein (.1)		Potri.001G266500 [exp]	10.81	0.7378
AT1G19360		RRA3	reduced residual arabinose 3, ...		Potri.002G134400 [exp]	12.64	0.7103
AT4G27280			Calcium-binding EF-hand family...		Potri.011G039500 [exp]	13.71	0.6770
AT3G05500			Rubber elongation factor prote...		Potri.002G206000 [exp]	14.96	0.7179
AT5G47100		ATCBL9, CBL9	calcineurin B-like protein 9 (...		Potri.001G150200 [exp]	26.94	0.7427	CBL1.4

Compare expression of checked genes

Potri.013G085201 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.