Potri.013G104601 [POPLAR]


External link
JGI Phytozome v13PopgenieAspWood                  
Symbol
Arabidopsis homologues

No hit found

Paralogs
Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description
Potri.019G077500 0 / 1 AT1G33980 321 / 3e-104 Smg-4/UPF3 family protein (.1.2)
Flax homologues

No hit found

PFAM info
Representative CDS sequence
>Potri.013G104601.1 pacid=42812525 polypeptide=Potri.013G104601.1.p locus=Potri.013G104601 ID=Potri.013G104601.1.v4.1 annot-version=v4.1
ATGCTAGCAATAATGCATTTTATTGCCCAGGAAACTGAGGGCATGTTGCAGCAGTTGAGCCTCGCATCTAATGTTGGAAGTTCTGCTTCTACTGCTGCTA
AACAGTATCAGAGGCATGAAGCTAGTGAGAGGCTGATAAAAAAGTATTCTTCCTTCAACAACTGCCTGGGCCCTGAAGAAATTTCAAAACCTGGATATTT
AGAGTTGACTAATCTAGAGGTGGAATATTTATGTATTTGGGTTTGCAGAAACACGTATGGGTTCAGAAGTCCTAAGGTTGTTAAAATCACTCATCAGGAT
AAATCTGATGTAGATACTACCCACAACCAATGCCCTGATATACAAAGTTCCCAGTAG
AA sequence
>Potri.013G104601.1 pacid=42812525 polypeptide=Potri.013G104601.1.p locus=Potri.013G104601 ID=Potri.013G104601.1.v4.1 annot-version=v4.1
MLAIMHFIAQETEGMLQQLSLASNVGSSASTAAKQYQRHEASERLIKKYSSFNNCLGPEEISKPGYLELTNLEVEYLCIWVCRNTYGFRSPKVVKITHQD
KSDVDTTHNQCPDIQSSQ

DESeq2's median of ratios [POPLAR]

Mapped by: Order by: Show schematic diagram

Coexpressed genes

Only top 10 genes are shown Show allDownload tab-delimited text
Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.
At best At TF class At alias At description Locus MR r Symbol NWA:WTNWB:WTNWA:OE-ARK2NWB:OE-ARK2NWA:miRNA-ARK2NWB:miRNA-ARK2NW 0hrWT H20WT-NWTUA1dEY NWTUA1dEY+TUB15 NWTUA1dY+TUB9 NWPde NWNWA:WT GANWBWT GATW:WTTW:WT GANWA:OE-ARK2 GANWB:OE-ARK2 GATW:OE-ARK2TW:OE-ARK2 GANWA:miRNA-ARK2 GANWB:miRNA-ARK2 GATW:miRNA-ARK2TW:miRNA-ARK2 GATW 2hrTW 8hrTW 24hrTW 48hrTW 96hrTW 336hrWT ACC35S::etr1-1 H2035S::etr1-1 ACCLMX5::etr1-1 H20LMX5::etr1-1 ACCWT-TWTUA1dEY TWTUA1dEY+TUB15 TWTUA1dY+TUB9 TWPde TWOW:WTOW:WT GAOW:OE-ARK2OW:OE-ARK2 GAOW:miRNA-ARK2OW:miRNA-ARK2 GAOW 2hrOW 8hrOW 24hrOW 48hrOW 96hrOW 336hrRoot CTRRoot LongColdRoot LongDrougtRoot LongHeatRoot LongSaltRoot ShortColdRoot ShortDrougtRoot ShortHeatRoot ShortSaltPtr rootLeaf CTRLeaf LongColdLeaf LongDrougtLeaf LongHeatLeaf LongSaltLeaf ShortColdLeaf ShortDrougtLeaf ShortHeatLeaf ShortSaltPtr leafStem CTRStem LongColdStem LongDrougtStem LongHeatStem LongSaltStem ShortColdStem ShortDrougtStem ShortHeatStem ShortSaltPtr shootPtr xylemPtr phloemPtr fiberPtr vesselPtr fiber vessel ray
Potri.013G104601 0 1
AT1G65550 Xanthine/uracil permease famil... Potri.014G015100 2.00 0.8159
AT2G42900 Plant basic secretory protein ... Potri.005G202300 6.48 0.7161
AT4G02570 AXR6, ATCUL1 AUXIN RESISTANT 6, cullin 1 (.... Potri.013G020000 8.83 0.7194
Potri.006G250500 17.08 0.7273
AT2G06530 VPS2.1 SNF7 family protein (.1) Potri.006G144300 19.36 0.6858
Potri.001G383801 20.44 0.6624
AT4G20280 TAF11 TBP-associated factor 11 (.1) Potri.003G157450 26.83 0.6541
AT5G13570 TDT, DCP2, ATDC... TRIDENT, decapping 2 (.1.2) Potri.010G222800 27.49 0.6652
Potri.001G379150 29.54 0.7073
Potri.002G047750 34.20 0.7072

Potri.013G104601 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.