Plant FIBer expression Database

Potri.013G125200 [POPLAR]


External link
JGI Phytozome v13PopgenieAspWood                  
Symbol
Arabidopsis homologues
Locus ID BLAST score/e-value TF class Alias TAIR10 short description
AT2G43640 167 / 8e-55 Signal recognition particle, SRP9/SRP14 subunit (.1.2.3)
Paralogs
Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description
Flax homologues

No hit found
PFAM info
Clan ID Clan name Pfam ID Pfam name Pfam description
CL0623 SRP9_14 PF02290 SRP14 Signal recognition particle 14kD protein
Representative CDS sequence
>Potri.013G125200.1 pacid=42812230 polypeptide=Potri.013G125200.1.p locus=Potri.013G125200 ID=Potri.013G125200.1.v4.1 annot-version=v4.1
ATGGTTCTCTTACAACTCGATCCGTTTCTCAATGAACTAACAACCTTGTATCAAAACAGCACCGACAAGGGCTCAATTTGGGTTACTCTTAAACGTTCTT
CGATGAAATCTAAGGTGCAAAGGAATAAGATGACAACGAATGGTGAACCCATTGAGTATAGATGTCTTATACGTGCAACCGATGGCAAAAAGACTATTTC
TACTTCGGTTGGGGCAAGGGATCACCAGCGTTTCCAAGCTTCTTATGCAACTATTCTCAAGGCTCACATGACAGCTCTAAAGAAGAGGGAAAGGAAGGAT
AAGAAAAAGGCAGCAGAAGGTGATAAGAAAGAAGGGGACGTAAAGAAGAAACCAAAGAGAGTCTGA
AA sequence
>Potri.013G125200.1 pacid=42812230 polypeptide=Potri.013G125200.1.p locus=Potri.013G125200 ID=Potri.013G125200.1.v4.1 annot-version=v4.1
MVLLQLDPFLNELTTLYQNSTDKGSIWVTLKRSSMKSKVQRNKMTTNGEPIEYRCLIRATDGKKTISTSVGARDHQRFQASYATILKAHMTALKKRERKD
KKKAAEGDKKEGDVKKKPKRV

DESeq2's median of ratios [POPLAR]

Mapped by: Order by: Show schematic diagram

Coexpressed genes

Only top 10 genes are shown Show allDownload tab-delimited text
Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.
At best At TF class At alias At description Locus MR r Symbol NWA:WTNWB:WTNWA:OE-ARK2NWB:OE-ARK2NWA:miRNA-ARK2NWB:miRNA-ARK2NW 0hrWT H20WT-NWTUA1dEY NWTUA1dEY+TUB15 NWTUA1dY+TUB9 NWPde NWNWA:WT GANWBWT GATW:WTTW:WT GANWA:OE-ARK2 GANWB:OE-ARK2 GATW:OE-ARK2TW:OE-ARK2 GANWA:miRNA-ARK2 GANWB:miRNA-ARK2 GATW:miRNA-ARK2TW:miRNA-ARK2 GATW 2hrTW 8hrTW 24hrTW 48hrTW 96hrTW 336hrWT ACC35S::etr1-1 H2035S::etr1-1 ACCLMX5::etr1-1 H20LMX5::etr1-1 ACCWT-TWTUA1dEY TWTUA1dEY+TUB15 TWTUA1dY+TUB9 TWPde TWOW:WTOW:WT GAOW:OE-ARK2OW:OE-ARK2 GAOW:miRNA-ARK2OW:miRNA-ARK2 GAOW 2hrOW 8hrOW 24hrOW 48hrOW 96hrOW 336hrRoot CTRRoot LongColdRoot LongDrougtRoot LongHeatRoot LongSaltRoot ShortColdRoot ShortDrougtRoot ShortHeatRoot ShortSaltPtr rootLeaf CTRLeaf LongColdLeaf LongDrougtLeaf LongHeatLeaf LongSaltLeaf ShortColdLeaf ShortDrougtLeaf ShortHeatLeaf ShortSaltPtr leafStem CTRStem LongColdStem LongDrougtStem LongHeatStem LongSaltStem ShortColdStem ShortDrougtStem ShortHeatStem ShortSaltPtr shootPtr xylemPtr phloemPtr fiberPtr vesselPtr fiber vessel ray
AT2G43640 Signal recognition particle, S... Potri.013G125200
[exp]
0 1
AT2G39960 Microsomal signal peptidase 25... Potri.010G192700
[exp]
1.73 0.9416
AT1G30630 Coatomer epsilon subunit (.1) Potri.011G155800
[exp]
3.31 0.9519 COPE2.1
AT4G29480 Mitochondrial ATP synthase sub... Potri.006G232000
[exp]
4.89 0.9290
AT1G60970 SNARE-like superfamily protein... Potri.003G043200
[exp]
5.09 0.9501
AT5G55190 RAN3, ATRAN3 RAN GTPase 3 (.1) Potri.006G250300
[exp]
6.32 0.9146 Pt-RAN1.2
AT3G52730 ubiquinol-cytochrome C reducta... Potri.004G188700
[exp]
6.92 0.9183
AT5G48580 FKBP15-2 FK506- and rapamycin-binding p... Potri.002G248200
[exp]
7.48 0.9301
AT5G60860 AtRABA1f RAB GTPase homolog A1F (.1) Potri.013G123600
[exp]
9.21 0.9352 Pt-RAB11.8
AT1G27390 TOM20-2 translocase outer membrane 20-... Potri.001G330200
[exp]
9.94 0.9286
AT5G13430 Ubiquinol-cytochrome C reducta... Potri.003G162200
[exp]
11.40 0.9226

Potri.013G125200 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.