Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser] Popgenie AspWood
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT2G22640 80 / 3e-21 ATBRK1, BRK1, HSPC300 BRICK1, putative (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description
Flax homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10019236 [exp] 84 / 5e-20 AT5G65620 1073 / 0.0 Zincin-like metalloproteases family protein (.1) Lus10004276 [exp] 80 / 1e-18 AT5G10540 1183 / 0.0 Zincin-like metalloproteases family protein (.1)
PFAM info
Representative CDS sequence Show only first row Show all	>Potri.014G010000.1 pacid=42764770 polypeptide=Potri.014G010000.1.p locus=Potri.014G010000 ID=Potri.014G010000.1.v4.1 annot-version=v4.1 ATGGCGAGAGCAGGCGGAGGAGGAGGAGGCGGAGGAGGGATAACAAACGCGGTGAACGTAGGGATAGCAGTACAAGCAGATTGGGAGAACAGAGAATTCA TATCTCACATATCTCTCAACATCCGTCGTCTCTTCGATTTCCTCATCCAATTTGAGTCCACCACCAAGTCCAAATTGTCTTCTCTCAATCTCAAGCTTGA TACTTTGGAGCGTCGTTTACAGCTTCTCGAACTCCAAGTTTCCACGGCCACTTCAAATCCTTCTCTTTTCACTTCCACCACTACCACCACCGCTTGA
AA sequence Show only first row Show all	>Potri.014G010000.1 pacid=42764770 polypeptide=Potri.014G010000.1.p locus=Potri.014G010000 ID=Potri.014G010000.1.v4.1 annot-version=v4.1 MARAGGGGGGGGGITNAVNVGIAVQADWENREFISHISLNIRRLFDFLIQFESTTKSKLSSLNLKLDTLERRLQLLELQVSTATSNPSLFTSTTTTTA

---

DESeq2's median of ratios [POPLAR]

Mapped by: StringTie Salmon Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	NWA:WT	NWB:WT	NWA:OE-ARK2	NWB:OE-ARK2	NWA:miRNA-ARK2	NWB:miRNA-ARK2	NW 0hr	WT H20	WT-NW	TUA1dEY NW	TUA1dEY+TUB15 NW	TUA1dY+TUB9 NW	Pde NW	NWA:WT GA	NWBWT GA	TW:WT	TW:WT GA	NWA:OE-ARK2 GA	NWB:OE-ARK2 GA	TW:OE-ARK2	TW:OE-ARK2 GA	NWA:miRNA-ARK2 GA	NWB:miRNA-ARK2 GA	TW:miRNA-ARK2	TW:miRNA-ARK2 GA	TW 2hr	TW 8hr	TW 24hr	TW 48hr	TW 96hr	TW 336hr	WT ACC	35S::etr1-1 H20	35S::etr1-1 ACC	LMX5::etr1-1 H20	LMX5::etr1-1 ACC	WT-TW	TUA1dEY TW	TUA1dEY+TUB15 TW	TUA1dY+TUB9 TW	Pde TW	OW:WT	OW:WT GA	OW:OE-ARK2	OW:OE-ARK2 GA	OW:miRNA-ARK2	OW:miRNA-ARK2 GA	OW 2hr	OW 8hr	OW 24hr	OW 48hr	OW 96hr	OW 336hr	Root CTR	Root LongCold	Root LongDrougt	Root LongHeat	Root LongSalt	Root ShortCold	Root ShortDrougt	Root ShortHeat	Root ShortSalt	Ptr root	Leaf CTR	Leaf LongCold	Leaf LongDrougt	Leaf LongHeat	Leaf LongSalt	Leaf ShortCold	Leaf ShortDrougt	Leaf ShortHeat	Leaf ShortSalt	Ptr leaf	Stem CTR	Stem LongCold	Stem LongDrougt	Stem LongHeat	Stem LongSalt	Stem ShortCold	Stem ShortDrougt	Stem ShortHeat	Stem ShortSalt	Ptr shoot	Ptr xylem	Ptr phloem	Ptr fiber	Ptr vessel	Ptr fiber vessel ray
AT2G22640		ATBRK1, BRK1, H...	BRICK1, putative (.1)		Potri.014G010000 [exp]	0	1
AT2G06530		VPS2.1	SNF7 family protein (.1)		Potri.001G170400 [exp]	3.46	0.7419
AT4G28610	GARP	ATPHR1, PHR1	phosphate starvation response ...		Potri.002G257800 [exp]	7.41	0.6391
AT5G23450		ATLCBK1	long-chain base (LCB) kinase 1...		Potri.010G255600 [exp]	7.74	0.6956
AT3G66654			Cyclophilin-like peptidyl-prol...		Potri.010G144500 [exp]	10.39	0.6375
AT5G54840		ATSGP1	Ras-related small GTP-binding ...		Potri.001G420700 [exp]	14.38	0.6205
AT1G65720			unknown protein		Potri.004G078500 [exp]	14.42	0.6193
AT3G24515		UBC37	ubiquitin-conjugating enzyme 3...		Potri.006G157600 [exp]	15.68	0.7133
AT2G27470	CCAAT	NF-YB11	"nuclear factor Y, subunit B11...		Potri.009G163500 [exp]	19.44	0.6147
AT5G32440			Ubiquitin system component Cue...		Potri.018G127200 [exp]	23.32	0.6285
AT3G28920	ZF_HD	ATHB34, ZHD9	ZINC FINGER HOMEODOMAIN 9, hom...		Potri.017G082900 [exp]	23.87	0.6087

Compare expression of checked genes

Potri.014G010000 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.