Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser] Popgenie AspWood
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT5G26667 358 / 2e-127 PYR6 P-loop containing nucleoside triphosphate hydrolases superfamily protein (.1.2.3) AT3G60180 307 / 9e-108 P-loop containing nucleoside triphosphate hydrolases superfamily protein (.1.2) AT4G25280 242 / 2e-81 P-loop containing nucleoside triphosphate hydrolases superfamily protein (.1) AT3G60961 204 / 5e-68 P-loop containing nucleoside triphosphate hydrolases superfamily protein (.1) AT5G35170 103 / 2e-25 adenylate kinase family protein (.1.2) AT5G47840 100 / 3e-25 AMK2 adenosine monophosphate kinase (.1) AT2G37250 85 / 8e-20 ADK, ATPADK1 adenosine kinase (.1) AT5G63400 83 / 3e-19 ADK1 adenylate kinase 1 (.1.2) AT2G39270 81 / 3e-18 P-loop containing nucleoside triphosphate hydrolases superfamily protein (.1) AT5G50370 78 / 2e-17 Adenylate kinase family protein (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.002G134600 [exp] 374 / 4e-134 AT5G26667 345 / 1e-122 P-loop containing nucleoside triphosphate hydrolases superfamily protein (.1.2.3) Potri.014G104700 [exp] 281 / 3e-97 AT5G26667 275 / 8e-95 P-loop containing nucleoside triphosphate hydrolases superfamily protein (.1.2.3) Potri.015G129000 [exp] 245 / 2e-82 AT4G25280 301 / 6e-104 P-loop containing nucleoside triphosphate hydrolases superfamily protein (.1) Potri.019G078200 [exp] 94 / 3e-23 AT5G47840 332 / 8e-115 adenosine monophosphate kinase (.1) Potri.013G103400 [exp] 93 / 1e-22 AT5G47840 347 / 1e-120 adenosine monophosphate kinase (.1) Potri.018G113400 [exp] 91 / 3e-21 AT5G35170 838 / 0.0 adenylate kinase family protein (.1.2) Potri.008G046100 [exp] 89 / 3e-21 AT2G37250 377 / 1e-132 adenosine kinase (.1) Potri.010G215300 [exp] 86 / 5e-20 AT2G37250 382 / 2e-134 adenosine kinase (.1) Potri.015G092800 [exp] 84 / 9e-20 AT5G63400 425 / 6e-153 adenylate kinase 1 (.1.2)
Flax homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10031611 [exp] 369 / 1e-131 AT5G26667 343 / 1e-121 P-loop containing nucleoside triphosphate hydrolases superfamily protein (.1.2.3) Lus10033733 [exp] 357 / 5e-126 AT5G26667 336 / 2e-117 P-loop containing nucleoside triphosphate hydrolases superfamily protein (.1.2.3) Lus10031714 [exp] 244 / 1e-76 AT4G25270 672 / 0.0 organelle transcript processing 70, Tetratricopeptide repeat (TPR)-like superfamily protein (.1) Lus10019509 [exp] 226 / 3e-76 AT5G26667 217 / 5e-73 P-loop containing nucleoside triphosphate hydrolases superfamily protein (.1.2.3) Lus10031135 [exp] 224 / 2e-74 AT4G25280 263 / 3e-89 P-loop containing nucleoside triphosphate hydrolases superfamily protein (.1) Lus10037995 [exp] 96 / 9e-25 AT5G47840 315 / 9e-110 adenosine monophosphate kinase (.1) Lus10009228 [exp] 97 / 3e-24 AT5G47840 296 / 3e-101 adenosine monophosphate kinase (.1) Lus10003504 [exp] 95 / 2e-23 AT5G47840 300 / 1e-102 adenosine monophosphate kinase (.1) Lus10009478 [exp] 90 / 1e-22 AT5G47840 293 / 1e-101 adenosine monophosphate kinase (.1) Lus10040358 [exp] 91 / 8e-22 AT2G37250 405 / 1e-143 adenosine kinase (.1)
PFAM info	Clan ID Clan name Pfam ID Pfam name Pfam description CL0023 [poplar] [flax] P-loop_NTPase PF13238 [poplar] [flax] AAA_18 AAA domain
Representative CDS sequence Show only first row Show all	>Potri.014G043300.7 pacid=42763463 polypeptide=Potri.014G043300.7.p locus=Potri.014G043300 ID=Potri.014G043300.7.v4.1 annot-version=v4.1 ATGGGGACTGCCGGTGATTCTGAGAAGAAGCCTACTGTTGTTTTTGTTTTGGGTGGCCCTGGAAGTGGAAAGGGTACCCAGTGTGCCAATATTGTCGAAC ACTTTGGTTACACTCATCTTAGTGCTGGAGATCTTCTTCGAGCAGAAATTAAATCTGGTTCTGAAAATGGAACCATGATTCAGAACATGATTAAGGAGGG CAAGATAGTGCCTTCAGAGGTAACAATAAAGCTCCTCCAAAAAGCAATGCAGGATAGTGGAAACGACAAATTTCTGATTGATGGCTTTCCCCGCAATGAG GAAAACCGAGCTGCTTTTGAAGCTGTTACCAAAATTGAGCCGGCATTTGTCCTTTTCTTTGATTGTCCTGAAGAGGAGATGGAGAGGCGTATTTTGAGCA GGAACCAGGGAAGAGAAGATGACAACATTGAGACAATAAGGAAGCGGTTTAAAGTTTTTCTAGAGTCTAGCCTTCCCGTGGTTGAGTATTATGAATCCAA GGGGAAAGTTCAAAAGGTTGATGCTGCAAAGCCTATTGATGAGGTTTTTGAGGTAGTTAAAGCCATCTTTACCCCAAAAGACGAGAAGGTAAAGCAGCAT TGCTGTGCTATCTTGTAG
AA sequence Show only first row Show all	>Potri.014G043300.7 pacid=42763463 polypeptide=Potri.014G043300.7.p locus=Potri.014G043300 ID=Potri.014G043300.7.v4.1 annot-version=v4.1 MGTAGDSEKKPTVVFVLGGPGSGKGTQCANIVEHFGYTHLSAGDLLRAEIKSGSENGTMIQNMIKEGKIVPSEVTIKLLQKAMQDSGNDKFLIDGFPRNE ENRAAFEAVTKIEPAFVLFFDCPEEEMERRILSRNQGREDDNIETIRKRFKVFLESSLPVVEYYESKGKVQKVDAAKPIDEVFEVVKAIFTPKDEKVKQH CCAIL

---

DESeq2's median of ratios [POPLAR]

Mapped by: StringTie Salmon Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	NWA:WT	NWB:WT	NWA:OE-ARK2	NWB:OE-ARK2	NWA:miRNA-ARK2	NWB:miRNA-ARK2	NW 0hr	WT H20	WT-NW	TUA1dEY NW	TUA1dEY+TUB15 NW	TUA1dY+TUB9 NW	Pde NW	NWA:WT GA	NWBWT GA	TW:WT	TW:WT GA	NWA:OE-ARK2 GA	NWB:OE-ARK2 GA	TW:OE-ARK2	TW:OE-ARK2 GA	NWA:miRNA-ARK2 GA	NWB:miRNA-ARK2 GA	TW:miRNA-ARK2	TW:miRNA-ARK2 GA	TW 2hr	TW 8hr	TW 24hr	TW 48hr	TW 96hr	TW 336hr	WT ACC	35S::etr1-1 H20	35S::etr1-1 ACC	LMX5::etr1-1 H20	LMX5::etr1-1 ACC	WT-TW	TUA1dEY TW	TUA1dEY+TUB15 TW	TUA1dY+TUB9 TW	Pde TW	OW:WT	OW:WT GA	OW:OE-ARK2	OW:OE-ARK2 GA	OW:miRNA-ARK2	OW:miRNA-ARK2 GA	OW 2hr	OW 8hr	OW 24hr	OW 48hr	OW 96hr	OW 336hr	Root CTR	Root LongCold	Root LongDrougt	Root LongHeat	Root LongSalt	Root ShortCold	Root ShortDrougt	Root ShortHeat	Root ShortSalt	Ptr root	Leaf CTR	Leaf LongCold	Leaf LongDrougt	Leaf LongHeat	Leaf LongSalt	Leaf ShortCold	Leaf ShortDrougt	Leaf ShortHeat	Leaf ShortSalt	Ptr leaf	Stem CTR	Stem LongCold	Stem LongDrougt	Stem LongHeat	Stem LongSalt	Stem ShortCold	Stem ShortDrougt	Stem ShortHeat	Stem ShortSalt	Ptr shoot	Ptr xylem	Ptr phloem	Ptr fiber	Ptr vessel	Ptr fiber vessel ray
AT5G26667		PYR6	P-loop containing nucleoside t...		Potri.014G043300 [exp]	0	1
AT1G10630		ATARFA1F	ADP-ribosylation factor A1F (....		Potri.008G100000 [exp]	3.60	0.9514	ARF1.3
AT1G09430		ACLA-3	ATP-citrate lyase A-3 (.1)		Potri.013G004400 [exp]	4.00	0.9475	ACLA.3
AT1G26300			BSD domain-containing protein ...		Potri.010G137900 [exp]	4.58	0.9453
AT5G11640			Thioredoxin superfamily protei...		Potri.006G237600 [exp]	10.00	0.9396
AT2G35020		GlcNAc1pUT2	N-acetylglucosamine-1-phosphat...		Potri.001G159700 [exp]	13.49	0.9303
AT1G53290			Galactosyltransferase family p...		Potri.011G111700 [exp]	13.56	0.9429
AT4G14960		TUA6	Tubulin/FtsZ family protein (....		Potri.001G289500 [exp]	14.07	0.9316	TUA2.1
AT5G19050			alpha/beta-Hydrolases superfam...		Potri.008G202300 [exp]	14.42	0.9240
AT1G09330		ECHIDNA, ECH	unknown protein		Potri.005G010400 [exp]	15.87	0.9394
AT3G09740		ATSYP71, SYP71	syntaxin of plants 71 (.1)		Potri.016G088200 [exp]	16.73	0.9290	SYP71.2

Compare expression of checked genes

Potri.014G043300 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.