Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser] Popgenie AspWood
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT1G02160 107 / 1e-32 Cox19 family protein (CHCH motif) (.1), Cox19 family protein (CHCH motif) (.2) AT5G09570 36 / 0.0004 Cox19-like CHCH family protein (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.001G282900 [exp] 36 / 0.0004 AT5G09570 142 / 2e-44 Cox19-like CHCH family protein (.1)
Flax homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10024637 [exp] 119 / 4e-37 AT1G02160 105 / 6e-32 Cox19 family protein (CHCH motif) (.1), Cox19 family protein (CHCH motif) (.2) Lus10032273 [exp] 118 / 7e-37 AT1G02160 103 / 4e-31 Cox19 family protein (CHCH motif) (.1), Cox19 family protein (CHCH motif) (.2)
PFAM info	Clan ID Clan name Pfam ID Pfam name Pfam description CL0351 [poplar] [flax] CHCH PF06747 [poplar] [flax] CHCH CHCH domain
Representative CDS sequence Show only first row Show all	>Potri.014G051850.1 pacid=42762864 polypeptide=Potri.014G051850.1.p locus=Potri.014G051850 ID=Potri.014G051850.1.v4.1 annot-version=v4.1 ATGGAATCAAAAGCAGCGGCACCGCCATACCAAAGTTCTGCAAGATTCGCAGACTCTCAATGTTACCCTCAATACACTGCTTCTCTCAAATGCTTGGAAG AGTTTGGCTCGGACAAAAGTAAATGTCAAGAGCATTTTGATGTTTACAAGGAATGCAAGAAAAAGGAGAGAGAAGCACGGTTGGAACGCAACAAGAGTCG CTCCCTCTTCTCATGA
AA sequence Show only first row Show all	>Potri.014G051850.1 pacid=42762864 polypeptide=Potri.014G051850.1.p locus=Potri.014G051850 ID=Potri.014G051850.1.v4.1 annot-version=v4.1 MESKAAAPPYQSSARFADSQCYPQYTASLKCLEEFGSDKSKCQEHFDVYKECKKKEREARLERNKSRSLFS

---

DESeq2's median of ratios [POPLAR]

Mapped by: StringTie Salmon Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	NWA:WT	NWB:WT	NWA:OE-ARK2	NWB:OE-ARK2	NWA:miRNA-ARK2	NWB:miRNA-ARK2	NW 0hr	WT H20	WT-NW	TUA1dEY NW	TUA1dEY+TUB15 NW	TUA1dY+TUB9 NW	Pde NW	NWA:WT GA	NWBWT GA	TW:WT	TW:WT GA	NWA:OE-ARK2 GA	NWB:OE-ARK2 GA	TW:OE-ARK2	TW:OE-ARK2 GA	NWA:miRNA-ARK2 GA	NWB:miRNA-ARK2 GA	TW:miRNA-ARK2	TW:miRNA-ARK2 GA	TW 2hr	TW 8hr	TW 24hr	TW 48hr	TW 96hr	TW 336hr	WT ACC	35S::etr1-1 H20	35S::etr1-1 ACC	LMX5::etr1-1 H20	LMX5::etr1-1 ACC	WT-TW	TUA1dEY TW	TUA1dEY+TUB15 TW	TUA1dY+TUB9 TW	Pde TW	OW:WT	OW:WT GA	OW:OE-ARK2	OW:OE-ARK2 GA	OW:miRNA-ARK2	OW:miRNA-ARK2 GA	OW 2hr	OW 8hr	OW 24hr	OW 48hr	OW 96hr	OW 336hr	Root CTR	Root LongCold	Root LongDrougt	Root LongHeat	Root LongSalt	Root ShortCold	Root ShortDrougt	Root ShortHeat	Root ShortSalt	Ptr root	Leaf CTR	Leaf LongCold	Leaf LongDrougt	Leaf LongHeat	Leaf LongSalt	Leaf ShortCold	Leaf ShortDrougt	Leaf ShortHeat	Leaf ShortSalt	Ptr leaf	Stem CTR	Stem LongCold	Stem LongDrougt	Stem LongHeat	Stem LongSalt	Stem ShortCold	Stem ShortDrougt	Stem ShortHeat	Stem ShortSalt	Ptr shoot	Ptr xylem	Ptr phloem	Ptr fiber	Ptr vessel	Ptr fiber vessel ray
AT1G02160			Cox19 family protein (CHCH mot...		Potri.014G051850 [exp]	0	1
AT3G46450			SEC14 cytosolic factor family ...		Potri.009G028700 [exp]	2.00	0.6430
AT5G16110			unknown protein		Potri.004G099800 [exp]	6.16	0.6425
AT5G51960			unknown protein		Potri.010G217300 [exp]	13.19	0.6179
AT3G28370			unknown protein		Potri.001G350100 [exp]	21.23	0.5383
AT1G47240		ATNRAMP2, NRAMP...	NRAMP metal ion transporter 2 ...		Potri.002G121000 [exp]	24.24	0.6385
AT5G59560		SRR1	SENSITIVITY TO RED LIGHT REDUC...		Potri.003G198000 [exp]	44.29	0.5704
AT5G38380			unknown protein		Potri.017G115200 [exp]	57.06	0.5392
AT1G49245			Prefoldin chaperone subunit fa...		Potri.013G072700 [exp]	63.08	0.5648
					Potri.018G071050 [exp]	82.65	0.5496
AT1G57680			unknown protein		Potri.003G003500 [exp]	83.96	0.5534

Compare expression of checked genes

Potri.014G051850 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.