Potri.014G084350 [POPLAR]


External link
JGI Phytozome v13PopgenieAspWood                  
Symbol
Arabidopsis homologues

No hit found

Paralogs
Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description
Potri.002G159800 100 / 2e-29 ND /
Potri.001G178400 48 / 5e-09 ND /
Flax homologues
Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description
Lus10027487 40 / 6e-06 ND /
Lus10039242 39 / 2e-05 ND 33 / 0.009
PFAM info
Representative CDS sequence
>Potri.014G084350.1 pacid=42764080 polypeptide=Potri.014G084350.1.p locus=Potri.014G084350 ID=Potri.014G084350.1.v4.1 annot-version=v4.1
ATGGATAATGAGAAGGGAGAGAGTAGTGGTGGTGATAATGCTGGAGCTAATGATGGCACAAGGAAGAAACTGTCTCAAGATGGAGCTGAAGCACTAAAGG
AGTGCCTGGAGGAAAACAAAGGGGACCATAACAAATGCAAATCCAAGATTGATGCTTTGGAATCTTCTTCTGCTCCAAGAAAACGACCCTTGCTACCTTT
AATACTCAAGAGTGATTCATTGACTGATGTTCAAAACAGGGTAGTAGTGGTAACCCACTAA
AA sequence
>Potri.014G084350.1 pacid=42764080 polypeptide=Potri.014G084350.1.p locus=Potri.014G084350 ID=Potri.014G084350.1.v4.1 annot-version=v4.1
MDNEKGESSGGDNAGANDGTRKKLSQDGAEALKECLEENKGDHNKCKSKIDALESSSAPRKRPLLPLILKSDSLTDVQNRVVVVTH

DESeq2's median of ratios [POPLAR]

Mapped by: Order by: Show schematic diagram

Coexpressed genes

Only top 10 genes are shown Show allDownload tab-delimited text
Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.
At best At TF class At alias At description Locus MR r Symbol NWA:WTNWB:WTNWA:OE-ARK2NWB:OE-ARK2NWA:miRNA-ARK2NWB:miRNA-ARK2NW 0hrWT H20WT-NWTUA1dEY NWTUA1dEY+TUB15 NWTUA1dY+TUB9 NWPde NWNWA:WT GANWBWT GATW:WTTW:WT GANWA:OE-ARK2 GANWB:OE-ARK2 GATW:OE-ARK2TW:OE-ARK2 GANWA:miRNA-ARK2 GANWB:miRNA-ARK2 GATW:miRNA-ARK2TW:miRNA-ARK2 GATW 2hrTW 8hrTW 24hrTW 48hrTW 96hrTW 336hrWT ACC35S::etr1-1 H2035S::etr1-1 ACCLMX5::etr1-1 H20LMX5::etr1-1 ACCWT-TWTUA1dEY TWTUA1dEY+TUB15 TWTUA1dY+TUB9 TWPde TWOW:WTOW:WT GAOW:OE-ARK2OW:OE-ARK2 GAOW:miRNA-ARK2OW:miRNA-ARK2 GAOW 2hrOW 8hrOW 24hrOW 48hrOW 96hrOW 336hrRoot CTRRoot LongColdRoot LongDrougtRoot LongHeatRoot LongSaltRoot ShortColdRoot ShortDrougtRoot ShortHeatRoot ShortSaltPtr rootLeaf CTRLeaf LongColdLeaf LongDrougtLeaf LongHeatLeaf LongSaltLeaf ShortColdLeaf ShortDrougtLeaf ShortHeatLeaf ShortSaltPtr leafStem CTRStem LongColdStem LongDrougtStem LongHeatStem LongSaltStem ShortColdStem ShortDrougtStem ShortHeatStem ShortSaltPtr shootPtr xylemPtr phloemPtr fiberPtr vesselPtr fiber vessel ray
Potri.014G084350 0 1
AT4G10250 ATHSP22.0 HSP20-like chaperones superfam... Potri.013G089200 11.13 0.9278
AT2G32120 HSP70T-2 heat-shock protein 70T-2 (.1.2... Potri.010G088600 15.09 0.9267
AT1G53540 HSP20-like chaperones superfam... Potri.001G238700 16.00 0.9241 Pt-HSP17.13
AT1G52560 HSP20-like chaperones superfam... Potri.001G192600 25.13 0.9137
AT4G25200 ATHSP23.6-MITO mitochondrion-localized small ... Potri.003G076000 28.98 0.9127
AT4G13640 GARP UNE16 unfertilized embryo sac 16, Ho... Potri.006G081001 30.88 0.9150
AT5G52640 AtHsp90-1, ATHS... HEAT SHOCK PROTEIN 83, HEAT SH... Potri.004G073600 32.61 0.9084
AT2G20560 DNAJ heat shock family protein... Potri.011G057601 33.58 0.9098
AT1G03070 Bax inhibitor-1 family protein... Potri.005G214000 34.87 0.9073
AT1G73240 unknown protein Potri.001G013300 36.74 0.8903

Potri.014G084350 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.