Plant FIBer expression Database

Potri.014G118800 [POPLAR]


External link
JGI Phytozome v13PopgenieAspWood                  
Symbol
Arabidopsis homologues

No hit found

Paralogs
Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description
Flax homologues
Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description
Lus10016265
[exp]
39 / 4e-05 AT3G66654 260 / 4e-88 Cyclophilin-like peptidyl-prolyl cis-trans isomerase family protein (.1.2.3)
Lus10012005
[exp]
37 / 0.0002 AT3G66654 259 / 5e-87 Cyclophilin-like peptidyl-prolyl cis-trans isomerase family protein (.1.2.3)
PFAM info
Representative CDS sequence
>Potri.014G118800.2 pacid=42763682 polypeptide=Potri.014G118800.2.p locus=Potri.014G118800 ID=Potri.014G118800.2.v4.1 annot-version=v4.1
ATGGGAAGGATCAAGCCTCAAGCTCTGCTGAAACAGAGCAAGAAGAAGAAAGCGCCGAGTCGAATAAGCATCGCTACTATTCTCTTATGCTGCTTCATTT
TTATATTGACTGTATTTTTCTTGTATTCTACGTATAAAACTGGTCGTTAA
AA sequence
>Potri.014G118800.2 pacid=42763682 polypeptide=Potri.014G118800.2.p locus=Potri.014G118800 ID=Potri.014G118800.2.v4.1 annot-version=v4.1
MGRIKPQALLKQSKKKKAPSRISIATILLCCFIFILTVFFLYSTYKTGR

DESeq2's median of ratios [POPLAR]

Mapped by: Order by: Show schematic diagram

Coexpressed genes

Only top 10 genes are shown Show allDownload tab-delimited text
Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.
At best At TF class At alias At description Locus MR r Symbol NWA:WTNWB:WTNWA:OE-ARK2NWB:OE-ARK2NWA:miRNA-ARK2NWB:miRNA-ARK2NW 0hrWT H20WT-NWTUA1dEY NWTUA1dEY+TUB15 NWTUA1dY+TUB9 NWPde NWNWA:WT GANWBWT GATW:WTTW:WT GANWA:OE-ARK2 GANWB:OE-ARK2 GATW:OE-ARK2TW:OE-ARK2 GANWA:miRNA-ARK2 GANWB:miRNA-ARK2 GATW:miRNA-ARK2TW:miRNA-ARK2 GATW 2hrTW 8hrTW 24hrTW 48hrTW 96hrTW 336hrWT ACC35S::etr1-1 H2035S::etr1-1 ACCLMX5::etr1-1 H20LMX5::etr1-1 ACCWT-TWTUA1dEY TWTUA1dEY+TUB15 TWTUA1dY+TUB9 TWPde TWOW:WTOW:WT GAOW:OE-ARK2OW:OE-ARK2 GAOW:miRNA-ARK2OW:miRNA-ARK2 GAOW 2hrOW 8hrOW 24hrOW 48hrOW 96hrOW 336hrRoot CTRRoot LongColdRoot LongDrougtRoot LongHeatRoot LongSaltRoot ShortColdRoot ShortDrougtRoot ShortHeatRoot ShortSaltPtr rootLeaf CTRLeaf LongColdLeaf LongDrougtLeaf LongHeatLeaf LongSaltLeaf ShortColdLeaf ShortDrougtLeaf ShortHeatLeaf ShortSaltPtr leafStem CTRStem LongColdStem LongDrougtStem LongHeatStem LongSaltStem ShortColdStem ShortDrougtStem ShortHeatStem ShortSaltPtr shootPtr xylemPtr phloemPtr fiberPtr vesselPtr fiber vessel ray
Potri.014G118800
[exp]
0 1
AT2G26530 AR781 Protein of unknown function (D... Potri.001G274000
[exp]
23.02 0.7890
AT5G36930 Disease resistance protein (TI... Potri.006G269950
[exp]
26.43 0.7880
AT2G21470 EMB2764, ATSAE2... EMBRYO DEFECTIVE 2764, SUMO-ac... Potri.009G120200
[exp]
31.84 0.7469
AT2G38890 unknown protein Potri.008G044500
[exp]
34.71 0.7792
AT1G13245 RTFL17, DVL4 DEVIL 4, ROTUNDIFOLIA like 17 ... Potri.010G129600
[exp]
37.62 0.7773
Potri.003G065701
[exp]
38.10 0.7709
AT2G02955 MEE12 maternal effect embryo arrest ... Potri.010G169500
[exp]
39.68 0.7757
AT1G78955 CAMS1 camelliol C synthase 1 (.1) Potri.011G085000
[exp]
40.49 0.7733 LCOSC2.5
AT1G73440 calmodulin-related (.1) Potri.014G060700
[exp]
46.47 0.7612
Potri.010G010851
[exp]
47.81 0.7742

Potri.014G118800 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.