Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser] Popgenie AspWood
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT3G62810 158 / 9e-52 complex 1 family protein / LVR family protein (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description
Flax homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10040570 [exp] 159 / 3e-52 AT3G62810 158 / 1e-51 complex 1 family protein / LVR family protein (.1) Lus10021599 [exp] 158 / 7e-52 AT3G62810 157 / 2e-51 complex 1 family protein / LVR family protein (.1)
PFAM info	Clan ID Clan name Pfam ID Pfam name Pfam description CL0491 [poplar] [flax] LYR-like PF05347 [poplar] [flax] Complex1_LYR Complex 1 protein (LYR family)
Representative CDS sequence Show only first row Show all	>Potri.014G129800.1 pacid=42763807 polypeptide=Potri.014G129800.1.p locus=Potri.014G129800 ID=Potri.014G129800.1.v4.1 annot-version=v4.1 ATGGTGAGAGGAGGAGAAGCATTGAGTGCATACAGAGCGTTGCTAAGAGCGACTCGAAAATCATTCACGGGCGACTCACTGATGCTGAAGGCATCAGCCT CCGAGGTTAGGAAGAAATTCGAGGAGAATCGTGATGTAAGCTCCGAGACTGAGATCCAGAAGCTCCTCGAAGAGGCCCGGGAAGCTTCCCATTTCATAGC TACCATGATCGTCCAAGCTAAACTCAACGACCGAGGCGGCTACGAAGTGAAGCCTGACAAAGACCATGCTGGAGCAACACTTGAGATTCCATCCGAAGAG ATTCTTCGGAAATCTGTCTAA
AA sequence Show only first row Show all	>Potri.014G129800.1 pacid=42763807 polypeptide=Potri.014G129800.1.p locus=Potri.014G129800 ID=Potri.014G129800.1.v4.1 annot-version=v4.1 MVRGGEALSAYRALLRATRKSFTGDSLMLKASASEVRKKFEENRDVSSETEIQKLLEEAREASHFIATMIVQAKLNDRGGYEVKPDKDHAGATLEIPSEE ILRKSV

---

DESeq2's median of ratios [POPLAR]

Mapped by: StringTie Salmon Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	NWA:WT	NWB:WT	NWA:OE-ARK2	NWB:OE-ARK2	NWA:miRNA-ARK2	NWB:miRNA-ARK2	NW 0hr	WT H20	WT-NW	TUA1dEY NW	TUA1dEY+TUB15 NW	TUA1dY+TUB9 NW	Pde NW	NWA:WT GA	NWBWT GA	TW:WT	TW:WT GA	NWA:OE-ARK2 GA	NWB:OE-ARK2 GA	TW:OE-ARK2	TW:OE-ARK2 GA	NWA:miRNA-ARK2 GA	NWB:miRNA-ARK2 GA	TW:miRNA-ARK2	TW:miRNA-ARK2 GA	TW 2hr	TW 8hr	TW 24hr	TW 48hr	TW 96hr	TW 336hr	WT ACC	35S::etr1-1 H20	35S::etr1-1 ACC	LMX5::etr1-1 H20	LMX5::etr1-1 ACC	WT-TW	TUA1dEY TW	TUA1dEY+TUB15 TW	TUA1dY+TUB9 TW	Pde TW	OW:WT	OW:WT GA	OW:OE-ARK2	OW:OE-ARK2 GA	OW:miRNA-ARK2	OW:miRNA-ARK2 GA	OW 2hr	OW 8hr	OW 24hr	OW 48hr	OW 96hr	OW 336hr	Root CTR	Root LongCold	Root LongDrougt	Root LongHeat	Root LongSalt	Root ShortCold	Root ShortDrougt	Root ShortHeat	Root ShortSalt	Ptr root	Leaf CTR	Leaf LongCold	Leaf LongDrougt	Leaf LongHeat	Leaf LongSalt	Leaf ShortCold	Leaf ShortDrougt	Leaf ShortHeat	Leaf ShortSalt	Ptr leaf	Stem CTR	Stem LongCold	Stem LongDrougt	Stem LongHeat	Stem LongSalt	Stem ShortCold	Stem ShortDrougt	Stem ShortHeat	Stem ShortSalt	Ptr shoot	Ptr xylem	Ptr phloem	Ptr fiber	Ptr vessel	Ptr fiber vessel ray
AT3G62810			complex 1 family protein / LVR...		Potri.014G129800 [exp]	0	1
AT2G28430			unknown protein		Potri.004G210800 [exp]	1.00	0.8602
					Potri.001G340100 [exp]	4.47	0.8199
AT3G59280		TXR1	THAXTOMIN A RESISTANT 1, Prote...		Potri.012G108600 [exp]	6.00	0.7884
AT3G09890			Ankyrin repeat family protein ...		Potri.006G121500 [exp]	6.32	0.8088
AT5G07900			Mitochondrial transcription te...		Potri.004G012400 [exp]	7.21	0.7481
AT1G29150		RPN6, ATS9	REGULATORY PARTICLE NON-ATPASE...		Potri.013G020300 [exp]	7.74	0.7668	ATS9.2
AT3G19760		EIF4A-III	eukaryotic initiation factor 4...		Potri.007G070000 [exp]	8.77	0.8014
AT4G26400			RING/U-box superfamily protein...		Potri.017G038300 [exp]	10.19	0.7871
AT2G14880			SWIB/MDM2 domain superfamily p...		Potri.009G092200 [exp]	11.66	0.7929
AT4G14110		FUS7, EMB143, C...	FUSCA 7, EMBRYO DEFECTIVE 143,...		Potri.001G207900 [exp]	12.96	0.7656	EMB143.2

Compare expression of checked genes

Potri.014G129800 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.