Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser] Popgenie AspWood
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT3G47510 53 / 1e-10 unknown protein AT1G74458 41 / 9e-06 unknown protein
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.008G087700 [exp] 50 / 2e-09 ND /
Flax homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10019094 [exp] 65 / 2e-14 AT3G47510 50 / 1e-08 unknown protein Lus10037168 [exp] 44 / 9e-07 ND 33 / 0.005 Lus10036759 [exp] 39 / 5e-05 ND 33 / 0.007 Lus10031340 [exp] 37 / 0.0001 ND 34 / 0.002
PFAM info
Representative CDS sequence Show only first row Show all	>Potri.015G062300.1 pacid=42774868 polypeptide=Potri.015G062300.1.p locus=Potri.015G062300 ID=Potri.015G062300.1.v4.1 annot-version=v4.1 ATGGCAGGAATGCTCTTTCGGTTACTTGTAAGCTTTTTGTTGATTTCTAACCTTGTTTATTGGAGCAATATTTCAATCTCAACAAGGAGAACTGGAAGTC AGGTGCATGGTCATGATCAAGTTCCTCCGATTCTTGACGACACCCACCTGGTACTCCAGAGCAAGAAGAAGGATCACGATGAACATATCGCACATGGAAG AAAGATTGTAGAACTCAACGATTATCCTGGATCTGGAGCCAACAATCGTCACACTCCAAGACCACAATTTGGCAGATGTGTTGATTGTTAG
AA sequence Show only first row Show all	>Potri.015G062300.1 pacid=42774868 polypeptide=Potri.015G062300.1.p locus=Potri.015G062300 ID=Potri.015G062300.1.v4.1 annot-version=v4.1 MAGMLFRLLVSFLLISNLVYWSNISISTRRTGSQVHGHDQVPPILDDTHLVLQSKKKDHDEHIAHGRKIVELNDYPGSGANNRHTPRPQFGRCVDC

---

DESeq2's median of ratios [POPLAR]

Mapped by: StringTie Salmon Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	NWA:WT	NWB:WT	NWA:OE-ARK2	NWB:OE-ARK2	NWA:miRNA-ARK2	NWB:miRNA-ARK2	NW 0hr	WT H20	WT-NW	TUA1dEY NW	TUA1dEY+TUB15 NW	TUA1dY+TUB9 NW	Pde NW	NWA:WT GA	NWBWT GA	TW:WT	TW:WT GA	NWA:OE-ARK2 GA	NWB:OE-ARK2 GA	TW:OE-ARK2	TW:OE-ARK2 GA	NWA:miRNA-ARK2 GA	NWB:miRNA-ARK2 GA	TW:miRNA-ARK2	TW:miRNA-ARK2 GA	TW 2hr	TW 8hr	TW 24hr	TW 48hr	TW 96hr	TW 336hr	WT ACC	35S::etr1-1 H20	35S::etr1-1 ACC	LMX5::etr1-1 H20	LMX5::etr1-1 ACC	WT-TW	TUA1dEY TW	TUA1dEY+TUB15 TW	TUA1dY+TUB9 TW	Pde TW	OW:WT	OW:WT GA	OW:OE-ARK2	OW:OE-ARK2 GA	OW:miRNA-ARK2	OW:miRNA-ARK2 GA	OW 2hr	OW 8hr	OW 24hr	OW 48hr	OW 96hr	OW 336hr	Root CTR	Root LongCold	Root LongDrougt	Root LongHeat	Root LongSalt	Root ShortCold	Root ShortDrougt	Root ShortHeat	Root ShortSalt	Ptr root	Leaf CTR	Leaf LongCold	Leaf LongDrougt	Leaf LongHeat	Leaf LongSalt	Leaf ShortCold	Leaf ShortDrougt	Leaf ShortHeat	Leaf ShortSalt	Ptr leaf	Stem CTR	Stem LongCold	Stem LongDrougt	Stem LongHeat	Stem LongSalt	Stem ShortCold	Stem ShortDrougt	Stem ShortHeat	Stem ShortSalt	Ptr shoot	Ptr xylem	Ptr phloem	Ptr fiber	Ptr vessel	Ptr fiber vessel ray
AT3G47510			unknown protein		Potri.015G062300 [exp]	0	1
AT3G60966			RING/U-box superfamily protein...		Potri.014G043200 [exp]	1.00	0.8857
AT5G22860			Serine carboxypeptidase S28 fa...		Potri.001G213500 [exp]	1.41	0.8685
AT2G37130			Peroxidase superfamily protein...		Potri.006G129900 [exp]	4.00	0.8211
AT1G33060	NAC	ANAC014	NAC 014 (.1.2)		Potri.002G154100 [exp]	6.85	0.7888
AT1G76990		ACR3	ACT domain repeat 3 (.1.2.3.4....		Potri.002G074800 [exp]	10.19	0.8043	Pt-ACR3.1
AT5G65140		TPPJ	trehalose-6-phosphate phosphat...		Potri.002G094500 [exp]	13.22	0.8456
AT3G53980			Bifunctional inhibitor/lipid-t...		Potri.016G104300 [exp]	13.85	0.8677
AT1G49470			Family of unknown function (DU...		Potri.009G108900 [exp]	13.96	0.8242
AT4G19810		ChiC	class V chitinase, Glycosyl hy...		Potri.018G112000 [exp]	15.87	0.8075
					Potri.013G007900 [exp]	20.85	0.8586

Compare expression of checked genes

Potri.015G062300 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.