Potri.015G088350 [POPLAR]


External link
JGI Phytozome v13PopgenieAspWood                  
Symbol
Arabidopsis homologues

No hit found

Paralogs
Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description
Potri.010G011550 149 / 1e-47 ND /
Potri.001G388001 145 / 1e-45 ND /
Potri.010G053902 132 / 8e-40 ND /
Potri.001G248708 66 / 2e-15 ND /
Flax homologues

No hit found

PFAM info
Representative CDS sequence
>Potri.015G088350.1 pacid=42775063 polypeptide=Potri.015G088350.1.p locus=Potri.015G088350 ID=Potri.015G088350.1.v4.1 annot-version=v4.1
ATGGAGCTGTTTGTTGAGACGCACGTACGGAGTGAAGACCGCCAAAAAGGGGTGCAACAGTTCATCGATAACCACGCTCAACACTTTGTGGAGACATATA
ATAGCTGGTTAAGGGAGAGATACAGAGATGATCCTTCGACCCACTCGGATTTCAATCCGGATTTGTGGATGGAGGCAAGATCGTCTGGTAGACCCGAAAA
AAATCGGGTGTACGGACTCTCCAACACTACGGCTGAGAACTTGCGGGTAGTCCATAGTGTCTCAACCAATGAGAGCTCCAATCGGTATCAAGGACCTAGT
CTTAGGAGTTCGTGGCCTTGCAACAACACACGACTCATCTCATTGAAAAATATGATCGACTCTCGGCTGATTATGAACAACTCTGCCAAATGA
AA sequence
>Potri.015G088350.1 pacid=42775063 polypeptide=Potri.015G088350.1.p locus=Potri.015G088350 ID=Potri.015G088350.1.v4.1 annot-version=v4.1
MELFVETHVRSEDRQKGVQQFIDNHAQHFVETYNSWLRERYRDDPSTHSDFNPDLWMEARSSGRPEKNRVYGLSNTTAENLRVVHSVSTNESSNRYQGPS
LRSSWPCNNTRLISLKNMIDSRLIMNNSAK

DESeq2's median of ratios [POPLAR]

Mapped by: Order by: Show schematic diagram

Coexpressed genes

Only top 10 genes are shown Show allDownload tab-delimited text
Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.
At best At TF class At alias At description Locus MR r Symbol NWA:WTNWB:WTNWA:OE-ARK2NWB:OE-ARK2NWA:miRNA-ARK2NWB:miRNA-ARK2NW 0hrWT H20WT-NWTUA1dEY NWTUA1dEY+TUB15 NWTUA1dY+TUB9 NWPde NWNWA:WT GANWBWT GATW:WTTW:WT GANWA:OE-ARK2 GANWB:OE-ARK2 GATW:OE-ARK2TW:OE-ARK2 GANWA:miRNA-ARK2 GANWB:miRNA-ARK2 GATW:miRNA-ARK2TW:miRNA-ARK2 GATW 2hrTW 8hrTW 24hrTW 48hrTW 96hrTW 336hrWT ACC35S::etr1-1 H2035S::etr1-1 ACCLMX5::etr1-1 H20LMX5::etr1-1 ACCWT-TWTUA1dEY TWTUA1dEY+TUB15 TWTUA1dY+TUB9 TWPde TWOW:WTOW:WT GAOW:OE-ARK2OW:OE-ARK2 GAOW:miRNA-ARK2OW:miRNA-ARK2 GAOW 2hrOW 8hrOW 24hrOW 48hrOW 96hrOW 336hrRoot CTRRoot LongColdRoot LongDrougtRoot LongHeatRoot LongSaltRoot ShortColdRoot ShortDrougtRoot ShortHeatRoot ShortSaltPtr rootLeaf CTRLeaf LongColdLeaf LongDrougtLeaf LongHeatLeaf LongSaltLeaf ShortColdLeaf ShortDrougtLeaf ShortHeatLeaf ShortSaltPtr leafStem CTRStem LongColdStem LongDrougtStem LongHeatStem LongSaltStem ShortColdStem ShortDrougtStem ShortHeatStem ShortSaltPtr shootPtr xylemPtr phloemPtr fiberPtr vesselPtr fiber vessel ray
Potri.015G088350 0 1
AT1G17030 unknown protein Potri.001G382000 1.73 0.9401
Potri.005G243501 2.44 0.9401
Potri.008G111650 4.58 0.9118
AT4G16295 SPH1 S-protein homologue 1 (.1) Potri.002G252500 8.36 0.8425
AT3G59600 NRPE8B, NRPD8B,... RNA polymerase Rpb8 (.1) Potri.013G120400 9.89 0.8183 ATRPABC16.1
Potri.014G057901 10.24 0.8162
Potri.003G073750 12.00 0.8590
Potri.001G448600 13.26 0.8158
AT3G26660 AS2 LBD24 LOB domain-containing protein ... Potri.015G135900 23.40 0.6940 LBD23.2
AT5G39400 ATPTEN1 Phosphatase and TENsin homolog... Potri.017G089700 47.71 0.7618

Potri.015G088350 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.