Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser] Popgenie AspWood
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT2G22830 130 / 2e-36 SQE2 squalene epoxidase 2 (.1) AT4G37760 129 / 4e-36 SQE3 squalene epoxidase 3 (.1) AT1G58440 114 / 1e-30 SQE1, XF1 SQUALENE EPOXIDASE 1, FAD/NAD(P)-binding oxidoreductase family protein (.1) AT5G24150 76 / 4e-17 SQP1, SQE5 SQUALENE MONOOXYGENASE 5, FAD/NAD(P)-binding oxidoreductase family protein (.1), FAD/NAD(P)-binding oxidoreductase family protein (.2) AT5G24160 72 / 9e-16 SQE6 squalene monoxygenase 6 (.1) AT5G24140 71 / 2e-15 SQP2 squalene monooxygenase 2 (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.015G120900 [exp] 148 / 3e-43 AT1G58440 745 / 0.0 SQUALENE EPOXIDASE 1, FAD/NAD(P)-binding oxidoreductase family protein (.1) Potri.002G114500 [exp] 135 / 2e-38 AT1G58440 761 / 0.0 SQUALENE EPOXIDASE 1, FAD/NAD(P)-binding oxidoreductase family protein (.1) Potri.005G146700 [exp] 134 / 4e-38 AT1G58440 766 / 0.0 SQUALENE EPOXIDASE 1, FAD/NAD(P)-binding oxidoreductase family protein (.1) Potri.007G007600 [exp] 134 / 7e-38 AT4G37760 795 / 0.0 squalene epoxidase 3 (.1) Potri.012G121136 [exp] 111 / 8e-30 AT1G58440 564 / 0.0 SQUALENE EPOXIDASE 1, FAD/NAD(P)-binding oxidoreductase family protein (.1) Potri.019G014378 [exp] 110 / 3e-29 AT1G58440 603 / 0.0 SQUALENE EPOXIDASE 1, FAD/NAD(P)-binding oxidoreductase family protein (.1) Potri.019G014376 [exp] 110 / 4e-29 AT1G58440 575 / 0.0 SQUALENE EPOXIDASE 1, FAD/NAD(P)-binding oxidoreductase family protein (.1)
Flax homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10011732 [exp] 134 / 7e-38 AT1G58440 785 / 0.0 SQUALENE EPOXIDASE 1, FAD/NAD(P)-binding oxidoreductase family protein (.1) Lus10039649 [exp] 134 / 9e-38 AT1G58440 791 / 0.0 SQUALENE EPOXIDASE 1, FAD/NAD(P)-binding oxidoreductase family protein (.1) Lus10007718 [exp] 131 / 7e-37 AT1G58440 828 / 0.0 SQUALENE EPOXIDASE 1, FAD/NAD(P)-binding oxidoreductase family protein (.1) Lus10018654 [exp] 131 / 9e-37 AT1G58440 827 / 0.0 SQUALENE EPOXIDASE 1, FAD/NAD(P)-binding oxidoreductase family protein (.1)
PFAM info	Clan ID Clan name Pfam ID Pfam name Pfam description CL0063 [poplar] [flax] NADP_Rossmann PF08491 [poplar] [flax] SE Squalene epoxidase
Representative CDS sequence Show only first row Show all	>Potri.015G121201.1 pacid=42775937 polypeptide=Potri.015G121201.1.p locus=Potri.015G121201 ID=Potri.015G121201.1.v4.1 annot-version=v4.1 ATGACTGTGGCTCTATCACACATTGTGCTACTACGTGATCTTCTTCGACCTCAACTCAATGATACATCTTCCTTTGCAAATATCCCCAGTCCTTCTACTC CCTGGCAAGTGGCACCTACCATAAGCACATTGGCAGGTGCCCTATACAAGGTGTTTAGGGCATCACCTGATCATCCAGCTAGAAACGAAATGTGCCAAGC ATGTTTTGACTACATGAGCCTTGAAGGAGTATTTTCGAATGGACTAATAGCTCTACTTTCTGGTCTAGACCCTCGACCGTTGAGCTCGGTTCTCCATTTC TTTGCAGTTGCTATCTATGGTGTTGGCCGCCTAAAGCTTCCCTTTAAGTCTAGTCTGCACTGTGCTTTCCCGCTTATGTAG
AA sequence Show only first row Show all	>Potri.015G121201.1 pacid=42775937 polypeptide=Potri.015G121201.1.p locus=Potri.015G121201 ID=Potri.015G121201.1.v4.1 annot-version=v4.1 MTVALSHIVLLRDLLRPQLNDTSSFANIPSPSTPWQVAPTISTLAGALYKVFRASPDHPARNEMCQACFDYMSLEGVFSNGLIALLSGLDPRPLSSVLHF FAVAIYGVGRLKLPFKSSLHCAFPLM

---

DESeq2's median of ratios [POPLAR]

Mapped by: StringTie Salmon Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	NWA:WT	NWB:WT	NWA:OE-ARK2	NWB:OE-ARK2	NWA:miRNA-ARK2	NWB:miRNA-ARK2	NW 0hr	WT H20	WT-NW	TUA1dEY NW	TUA1dEY+TUB15 NW	TUA1dY+TUB9 NW	Pde NW	NWA:WT GA	NWBWT GA	TW:WT	TW:WT GA	NWA:OE-ARK2 GA	NWB:OE-ARK2 GA	TW:OE-ARK2	TW:OE-ARK2 GA	NWA:miRNA-ARK2 GA	NWB:miRNA-ARK2 GA	TW:miRNA-ARK2	TW:miRNA-ARK2 GA	TW 2hr	TW 8hr	TW 24hr	TW 48hr	TW 96hr	TW 336hr	WT ACC	35S::etr1-1 H20	35S::etr1-1 ACC	LMX5::etr1-1 H20	LMX5::etr1-1 ACC	WT-TW	TUA1dEY TW	TUA1dEY+TUB15 TW	TUA1dY+TUB9 TW	Pde TW	OW:WT	OW:WT GA	OW:OE-ARK2	OW:OE-ARK2 GA	OW:miRNA-ARK2	OW:miRNA-ARK2 GA	OW 2hr	OW 8hr	OW 24hr	OW 48hr	OW 96hr	OW 336hr	Root CTR	Root LongCold	Root LongDrougt	Root LongHeat	Root LongSalt	Root ShortCold	Root ShortDrougt	Root ShortHeat	Root ShortSalt	Ptr root	Leaf CTR	Leaf LongCold	Leaf LongDrougt	Leaf LongHeat	Leaf LongSalt	Leaf ShortCold	Leaf ShortDrougt	Leaf ShortHeat	Leaf ShortSalt	Ptr leaf	Stem CTR	Stem LongCold	Stem LongDrougt	Stem LongHeat	Stem LongSalt	Stem ShortCold	Stem ShortDrougt	Stem ShortHeat	Stem ShortSalt	Ptr shoot	Ptr xylem	Ptr phloem	Ptr fiber	Ptr vessel	Ptr fiber vessel ray
AT2G22830		SQE2	squalene epoxidase 2 (.1)		Potri.015G121201 [exp]	0	1
AT5G52300		LTI65, RD29B	RESPONSIVE TO DESSICATION 29B,...		Potri.015G143950 [exp]	9.16	0.6566
AT1G51660		ATMKK4, ATMEK4	ARABIDOPSIS THALIANA MITOGEN-A...		Potri.013G110450 [exp]	12.80	0.6507
AT2G30720			Thioesterase/thiol ester dehyd...		Potri.017G009800 [exp]	17.29	0.5808
AT3G58610			ketol-acid reductoisomerase (....		Potri.013G117532 [exp]	30.90	0.6448
AT2G19080			metaxin-related (.1)		Potri.001G065000 [exp]	36.87	0.6193
AT3G23200			Uncharacterised protein family...		Potri.010G073000 [exp]	43.05	0.6164
AT2G24370			Protein kinase protein with ad...		Potri.011G008356 [exp]	50.89	0.6135
AT1G26820		RNS3	ribonuclease 3 (.1)		Potri.010G168600 [exp]	56.49	0.5988	S.1
AT1G15780			unknown protein		Potri.003G025500 [exp]	58.36	0.5980
AT1G48550			Vacuolar protein sorting-assoc...		Potri.015G037600 [exp]	67.17	0.5713

Compare expression of checked genes

Potri.015G121201 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.