Potri.015G125300 [POPLAR]


External link
JGI Phytozome v13PopgenieAspWood                  
Symbol
Arabidopsis homologues

No hit found

Paralogs
Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description
Potri.012G124666 39 / 0.0002 ND /
Flax homologues

No hit found

PFAM info
Representative CDS sequence
>Potri.015G125300.1 pacid=42775840 polypeptide=Potri.015G125300.1.p locus=Potri.015G125300 ID=Potri.015G125300.1.v4.1 annot-version=v4.1
ATGAAGATTATTCAGTGGATTAAAAAGATGTTCCGGAAGTTGCTGAATAAAAAGGTTGTTGAACGGCAAACTAGGCCTGATGATTTTTTGAGAGAGGATC
AAGAAGCTTTACTAGAAAGAAATCCCCATGGAGACCTAACATGCCAACGTTGTATGAAGGAAATGAATGGCCTTGAGGAACAAGTAGCTCACAAAGACAA
GGAAATACAGTACTATAAGAGAGCCCTTAGTGATAAGAATCAGGAAATTCGAAGGCTTAAGAATATGAATATGCCACAGAACCCACAGAGCAGACTATGG
TATCCAGAAGAAGACATACTTGGAGCACGTCCATCTCAGGGAGAAAACCGTACTCCATCGGGATTAAATTAG
AA sequence
>Potri.015G125300.1 pacid=42775840 polypeptide=Potri.015G125300.1.p locus=Potri.015G125300 ID=Potri.015G125300.1.v4.1 annot-version=v4.1
MKIIQWIKKMFRKLLNKKVVERQTRPDDFLREDQEALLERNPHGDLTCQRCMKEMNGLEEQVAHKDKEIQYYKRALSDKNQEIRRLKNMNMPQNPQSRLW
YPEEDILGARPSQGENRTPSGLN

DESeq2's median of ratios [POPLAR]

Mapped by: Order by: Show schematic diagram

Coexpressed genes

Only top 10 genes are shown Show allDownload tab-delimited text
Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.
At best At TF class At alias At description Locus MR r Symbol NWA:WTNWB:WTNWA:OE-ARK2NWB:OE-ARK2NWA:miRNA-ARK2NWB:miRNA-ARK2NW 0hrWT H20WT-NWTUA1dEY NWTUA1dEY+TUB15 NWTUA1dY+TUB9 NWPde NWNWA:WT GANWBWT GATW:WTTW:WT GANWA:OE-ARK2 GANWB:OE-ARK2 GATW:OE-ARK2TW:OE-ARK2 GANWA:miRNA-ARK2 GANWB:miRNA-ARK2 GATW:miRNA-ARK2TW:miRNA-ARK2 GATW 2hrTW 8hrTW 24hrTW 48hrTW 96hrTW 336hrWT ACC35S::etr1-1 H2035S::etr1-1 ACCLMX5::etr1-1 H20LMX5::etr1-1 ACCWT-TWTUA1dEY TWTUA1dEY+TUB15 TWTUA1dY+TUB9 TWPde TWOW:WTOW:WT GAOW:OE-ARK2OW:OE-ARK2 GAOW:miRNA-ARK2OW:miRNA-ARK2 GAOW 2hrOW 8hrOW 24hrOW 48hrOW 96hrOW 336hrRoot CTRRoot LongColdRoot LongDrougtRoot LongHeatRoot LongSaltRoot ShortColdRoot ShortDrougtRoot ShortHeatRoot ShortSaltPtr rootLeaf CTRLeaf LongColdLeaf LongDrougtLeaf LongHeatLeaf LongSaltLeaf ShortColdLeaf ShortDrougtLeaf ShortHeatLeaf ShortSaltPtr leafStem CTRStem LongColdStem LongDrougtStem LongHeatStem LongSaltStem ShortColdStem ShortDrougtStem ShortHeatStem ShortSaltPtr shootPtr xylemPtr phloemPtr fiberPtr vesselPtr fiber vessel ray
Potri.015G125300 0 1
AT5G06740 Concanavalin A-like lectin pro... Potri.004G209300 2.44 0.9967
AT1G35210 unknown protein Potri.005G161700 5.74 0.9947
AT1G16260 Wall-associated kinase family ... Potri.003G185800 7.21 0.9948
AT4G14746 unknown protein Potri.013G039300 10.58 0.9944 Pt-MTN26.2
AT2G29120 ATGLR2.7 GLUTAMATE RECEPTOR 2.7, gluta... Potri.001G374800 12.96 0.9947
AT1G05200 GLUR3, ATGLR3.4 glutamate receptor 3.4 (.1.2) Potri.011G063000 15.49 0.9930
AT1G78780 pathogenesis-related family pr... Potri.005G188300 16.70 0.9934
AT2G29120 ATGLR2.7 GLUTAMATE RECEPTOR 2.7, gluta... Potri.001G374700 17.02 0.9946
AT2G29120 ATGLR2.7 GLUTAMATE RECEPTOR 2.7, gluta... Potri.001G374600 17.14 0.9945
Potri.006G106150 19.07 0.9932

Potri.015G125300 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.