Plant FIBer expression Database

Potri.016G002900 [POPLAR]


External link
JGI Phytozome v13PopgenieAspWood                  
Symbol
Arabidopsis homologues

No hit found

Paralogs
Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description
Potri.006G017750
[exp]
107 / 2e-32 ND /
Potri.006G002301
[exp]
106 / 4e-32 ND /
Potri.006G002401
[exp]
93 / 1e-26 ND /
Flax homologues
Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description
Lus10018816
[exp]
64 / 2e-15 ND /
PFAM info
Representative CDS sequence
>Potri.016G002900.1 pacid=42808915 polypeptide=Potri.016G002900.1.p locus=Potri.016G002900 ID=Potri.016G002900.1.v4.1 annot-version=v4.1
ATGGTGAGAAAGGAAACTGTATCTGTGGCTTTCATGGCTAGCCTCCTCTTGGTGGCATCCTTCACCATTTGTGCACATGCAACTGAAGGTCCTCGTATGC
TGGCATCCGAGAAAGTGTATTATCCTCAAGGTTGTCGCTGCTGCTTCTTTGTCGGAAGGATACCAAACATGCGCTGTGGAAAAGTATGCTGCACTAGCAT
TAGAGGAGAGAACTGCTGCATCGGAACATAA
AA sequence
>Potri.016G002900.1 pacid=42808915 polypeptide=Potri.016G002900.1.p locus=Potri.016G002900 ID=Potri.016G002900.1.v4.1 annot-version=v4.1
MVRKETVSVAFMASLLLVASFTICAHATEGPRMLASEKVYYPQGCRCCFFVGRIPNMRCGKVCCTSIRGENCCIGT

DESeq2's median of ratios [POPLAR]

Mapped by: Order by: Show schematic diagram

Coexpressed genes

Only top 10 genes are shown Show allDownload tab-delimited text
Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.
At best At TF class At alias At description Locus MR r Symbol NWA:WTNWB:WTNWA:OE-ARK2NWB:OE-ARK2NWA:miRNA-ARK2NWB:miRNA-ARK2NW 0hrWT H20WT-NWTUA1dEY NWTUA1dEY+TUB15 NWTUA1dY+TUB9 NWPde NWNWA:WT GANWBWT GATW:WTTW:WT GANWA:OE-ARK2 GANWB:OE-ARK2 GATW:OE-ARK2TW:OE-ARK2 GANWA:miRNA-ARK2 GANWB:miRNA-ARK2 GATW:miRNA-ARK2TW:miRNA-ARK2 GATW 2hrTW 8hrTW 24hrTW 48hrTW 96hrTW 336hrWT ACC35S::etr1-1 H2035S::etr1-1 ACCLMX5::etr1-1 H20LMX5::etr1-1 ACCWT-TWTUA1dEY TWTUA1dEY+TUB15 TWTUA1dY+TUB9 TWPde TWOW:WTOW:WT GAOW:OE-ARK2OW:OE-ARK2 GAOW:miRNA-ARK2OW:miRNA-ARK2 GAOW 2hrOW 8hrOW 24hrOW 48hrOW 96hrOW 336hrRoot CTRRoot LongColdRoot LongDrougtRoot LongHeatRoot LongSaltRoot ShortColdRoot ShortDrougtRoot ShortHeatRoot ShortSaltPtr rootLeaf CTRLeaf LongColdLeaf LongDrougtLeaf LongHeatLeaf LongSaltLeaf ShortColdLeaf ShortDrougtLeaf ShortHeatLeaf ShortSaltPtr leafStem CTRStem LongColdStem LongDrougtStem LongHeatStem LongSaltStem ShortColdStem ShortDrougtStem ShortHeatStem ShortSaltPtr shootPtr xylemPtr phloemPtr fiberPtr vesselPtr fiber vessel ray
Potri.016G002900
[exp]
0 1
AT5G19790 AP2_ERF RAP2.11 related to AP2 11 (.1) Potri.001G453100
[exp]
2.23 0.9085
AT4G14880 OLD3, CYTACS1, ... ONSET OF LEAF DEATH 3, O-acety... Potri.005G048700
[exp]
7.34 0.7832
AT1G78830 Curculin-like (mannose-binding... Potri.011G066200
[exp]
7.61 0.9021
Potri.012G075550
[exp]
12.32 0.7974
AT4G21410 CRK29 cysteine-rich RLK (RECEPTOR-li... Potri.011G029000
[exp]
17.17 0.8640
AT1G05577 Domain of unknown function (DU... Potri.001G232300
[exp]
17.49 0.8764
AT1G11330 S-locus lectin protein kinase ... Potri.011G038000
[exp]
19.74 0.8319
AT5G54380 THE1 THESEUS1, protein kinase famil... Potri.005G108300
[exp]
31.89 0.8482
AT1G11330 S-locus lectin protein kinase ... Potri.011G038401
[exp]
41.20 0.8589
AT4G21410 CRK29 cysteine-rich RLK (RECEPTOR-li... Potri.011G029700
[exp]
41.85 0.8382

Potri.016G002900 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.