Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser] Popgenie AspWood
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT2G41290 69 / 3e-15 SSL2 strictosidine synthase-like 2 (.1) AT3G57030 68 / 9e-15 Calcium-dependent phosphotriesterase superfamily protein (.1) AT3G57020 60 / 6e-12 Calcium-dependent phosphotriesterase superfamily protein (.1.2) AT3G57010 58 / 3e-11 Calcium-dependent phosphotriesterase superfamily protein (.1) AT1G08470 56 / 1e-10 SSL3 strictosidine synthase-like 3 (.1) AT5G22020 55 / 4e-10 Calcium-dependent phosphotriesterase superfamily protein (.1) AT2G41300 50 / 1e-08 SSL1 strictosidine synthase-like 1 (.1) AT3G59530 49 / 4e-08 LAP3 LESS ADHERENT POLLEN 3, Calcium-dependent phosphotriesterase superfamily protein (.1.2) AT1G74020 40 / 5e-05 SS2 strictosidine synthase 2 (.1) AT1G74000 40 / 6e-05 SS3 strictosidine synthase 3 (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.016G037700 [exp] 78 / 3e-18 AT2G41290 402 / 3e-139 strictosidine synthase-like 2 (.1) Potri.006G040900 [exp] 71 / 7e-16 AT2G41290 381 / 4e-131 strictosidine synthase-like 2 (.1) Potri.016G037900 [exp] 62 / 9e-13 AT3G57030 523 / 0.0 Calcium-dependent phosphotriesterase superfamily protein (.1) Potri.T015518 [exp] 58 / 4e-11 AT3G57030 318 / 5e-107 Calcium-dependent phosphotriesterase superfamily protein (.1) Potri.008G109966 [exp] 58 / 4e-11 AT3G57030 318 / 5e-107 Calcium-dependent phosphotriesterase superfamily protein (.1) Potri.001G214500 [exp] 55 / 5e-10 AT1G08470 628 / 0.0 strictosidine synthase-like 3 (.1) Potri.017G027600 [exp] 54 / 1e-09 AT3G59530 640 / 0.0 LESS ADHERENT POLLEN 3, Calcium-dependent phosphotriesterase superfamily protein (.1.2) Potri.007G130700 [exp] 54 / 1e-09 AT3G59530 662 / 0.0 LESS ADHERENT POLLEN 3, Calcium-dependent phosphotriesterase superfamily protein (.1.2) Potri.015G037700 [exp] 43 / 8e-06 AT1G74000 218 / 7e-69 strictosidine synthase 3 (.1)
Flax homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10010448 [exp] 55 / 4e-11 AT2G41290 61 / 3e-12 strictosidine synthase-like 2 (.1) Lus10013370 [exp] 54 / 7e-10 AT1G08470 520 / 0.0 strictosidine synthase-like 3 (.1) Lus10008451 [exp] 53 / 3e-09 AT1G08470 600 / 0.0 strictosidine synthase-like 3 (.1) Lus10019377 [exp] 52 / 4e-09 AT3G59530 609 / 0.0 LESS ADHERENT POLLEN 3, Calcium-dependent phosphotriesterase superfamily protein (.1.2) Lus10008151 [exp] 52 / 6e-09 AT3G59530 613 / 0.0 LESS ADHERENT POLLEN 3, Calcium-dependent phosphotriesterase superfamily protein (.1.2) Lus10029600 [exp] 47 / 1e-07 AT3G57010 56 / 3e-09 Calcium-dependent phosphotriesterase superfamily protein (.1) Lus10012095 [exp] 47 / 4e-07 AT2G41290 291 / 2e-96 strictosidine synthase-like 2 (.1) Lus10006331 [exp] 45 / 1e-06 AT3G57030 239 / 1e-76 Calcium-dependent phosphotriesterase superfamily protein (.1) Lus10029599 [exp] 44 / 2e-06 AT3G57030 204 / 3e-63 Calcium-dependent phosphotriesterase superfamily protein (.1) Lus10006330 [exp] 44 / 5e-06 AT3G57030 224 / 2e-70 Calcium-dependent phosphotriesterase superfamily protein (.1)
PFAM info
Representative CDS sequence Show only first row Show all	>Potri.016G037800.2 pacid=42810378 polypeptide=Potri.016G037800.2.p locus=Potri.016G037800 ID=Potri.016G037800.2.v4.1 annot-version=v4.1 ATGGCTGCAAAGCTATTCTTAACAGCAACAATTGTAGTTCTAATATCAGCCTTGATTGCAATTAATCATGAGTGTTTGTATCAACCATCTGTTATAGAAA AAGGCCACGGCCAGCTTTGGGAATGGGAAACTCTTTCACTCGATGGTGCAACCGGACCTGAAAGTTTTGCTCTCGACCCACTTGGCCAGGGACCCTATGC CGGAATATCCGACGGTCGAATCATCAAATGGGAAGAACACGAAAGGCGTTGGATCAATTTTGCAATTACTTCTCAAAAGAGCTTACGCGCAACATAA
AA sequence Show only first row Show all	>Potri.016G037800.2 pacid=42810378 polypeptide=Potri.016G037800.2.p locus=Potri.016G037800 ID=Potri.016G037800.2.v4.1 annot-version=v4.1 MAAKLFLTATIVVLISALIAINHECLYQPSVIEKGHGQLWEWETLSLDGATGPESFALDPLGQGPYAGISDGRIIKWEEHERRWINFAITSQKSLRAT

---

DESeq2's median of ratios [POPLAR]

Mapped by: StringTie Salmon Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	NWA:WT	NWB:WT	NWA:OE-ARK2	NWB:OE-ARK2	NWA:miRNA-ARK2	NWB:miRNA-ARK2	NW 0hr	WT H20	WT-NW	TUA1dEY NW	TUA1dEY+TUB15 NW	TUA1dY+TUB9 NW	Pde NW	NWA:WT GA	NWBWT GA	TW:WT	TW:WT GA	NWA:OE-ARK2 GA	NWB:OE-ARK2 GA	TW:OE-ARK2	TW:OE-ARK2 GA	NWA:miRNA-ARK2 GA	NWB:miRNA-ARK2 GA	TW:miRNA-ARK2	TW:miRNA-ARK2 GA	TW 2hr	TW 8hr	TW 24hr	TW 48hr	TW 96hr	TW 336hr	WT ACC	35S::etr1-1 H20	35S::etr1-1 ACC	LMX5::etr1-1 H20	LMX5::etr1-1 ACC	WT-TW	TUA1dEY TW	TUA1dEY+TUB15 TW	TUA1dY+TUB9 TW	Pde TW	OW:WT	OW:WT GA	OW:OE-ARK2	OW:OE-ARK2 GA	OW:miRNA-ARK2	OW:miRNA-ARK2 GA	OW 2hr	OW 8hr	OW 24hr	OW 48hr	OW 96hr	OW 336hr	Root CTR	Root LongCold	Root LongDrougt	Root LongHeat	Root LongSalt	Root ShortCold	Root ShortDrougt	Root ShortHeat	Root ShortSalt	Ptr root	Leaf CTR	Leaf LongCold	Leaf LongDrougt	Leaf LongHeat	Leaf LongSalt	Leaf ShortCold	Leaf ShortDrougt	Leaf ShortHeat	Leaf ShortSalt	Ptr leaf	Stem CTR	Stem LongCold	Stem LongDrougt	Stem LongHeat	Stem LongSalt	Stem ShortCold	Stem ShortDrougt	Stem ShortHeat	Stem ShortSalt	Ptr shoot	Ptr xylem	Ptr phloem	Ptr fiber	Ptr vessel	Ptr fiber vessel ray
AT2G41290		SSL2	strictosidine synthase-like 2 ...		Potri.016G037800 [exp]	0	1
AT2G41290		SSL2	strictosidine synthase-like 2 ...		Potri.016G037700 [exp]	1.00	0.9168
					Potri.004G099433 [exp]	5.00	0.7917
AT4G16130		ATISA1, ARA1	arabinose kinase (.1)		Potri.018G145700 [exp]	6.48	0.8212	Pt-ARA1.1
AT4G16130		ATISA1, ARA1	arabinose kinase (.1)		Potri.018G138202 [exp]	10.95	0.7861
AT5G49120			Protein of unknown function (D...		Potri.010G011700 [exp]	14.83	0.7714
AT3G61980			serine protease inhibitor, Kaz...		Potri.014G108700 [exp]	17.29	0.7640
AT5G41761			unknown protein		Potri.002G167900 [exp]	18.33	0.7654
AT2G47480			Protein of unknown function (D...		Potri.010G140800 [exp]	21.90	0.7536
AT3G60580	C2H2ZnF		C2H2-like zinc finger protein ...		Potri.002G143800 [exp]	22.27	0.7503
AT4G37260	MYB	ATMYB73	myb domain protein 73 (.1)		Potri.009G096000 [exp]	22.75	0.6914

Compare expression of checked genes

Potri.016G037800 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.