Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser] Popgenie AspWood
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT3G53560 127 / 4e-37 Tetratricopeptide repeat (TPR)-like superfamily protein (.1) AT2G37400 126 / 5e-37 Tetratricopeptide repeat (TPR)-like superfamily protein (.1) AT5G02590 101 / 2e-27 Tetratricopeptide repeat (TPR)-like superfamily protein (.1) AT3G09490 77 / 4e-18 Tetratricopeptide repeat (TPR)-like superfamily protein (.1) AT4G39470 71 / 3e-16 Tetratricopeptide repeat (TPR)-like superfamily protein (.1) AT3G18420 62 / 4e-13 Protein prenylyltransferase superfamily protein (.1) AT1G78915 42 / 6e-06 Tetratricopeptide repeat (TPR)-like superfamily protein (.1), Tetratricopeptide repeat (TPR)-like superfamily protein (.2), Tetratricopeptide repeat (TPR)-like superfamily protein (.3)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.016G080000 [exp] 167 / 1e-52 AT2G37400 342 / 4e-117 Tetratricopeptide repeat (TPR)-like superfamily protein (.1) Potri.006G213600 [exp] 152 / 4e-47 AT3G53560 327 / 1e-111 Tetratricopeptide repeat (TPR)-like superfamily protein (.1) Potri.007G079200 [exp] 71 / 5e-16 AT4G39470 314 / 5e-106 Tetratricopeptide repeat (TPR)-like superfamily protein (.1) Potri.005G085700 [exp] 69 / 3e-15 AT4G39470 296 / 7e-99 Tetratricopeptide repeat (TPR)-like superfamily protein (.1) Potri.008G143600 [exp] 62 / 7e-13 AT3G18420 356 / 4e-123 Protein prenylyltransferase superfamily protein (.1) Potri.010G098500 [exp] 60 / 3e-12 AT3G18420 328 / 5e-112 Protein prenylyltransferase superfamily protein (.1) Potri.008G142980 [exp] 58 / 6e-12 AT3G18420 244 / 5e-82 Protein prenylyltransferase superfamily protein (.1) Potri.008G003800 [exp] 38 / 0.0002 AT1G78915 448 / 3e-157 Tetratricopeptide repeat (TPR)-like superfamily protein (.1), Tetratricopeptide repeat (TPR)-like superfamily protein (.2), Tetratricopeptide repeat (TPR)-like superfamily protein (.3)
Flax homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10024433 [exp] 113 / 9e-32 AT2G37400 271 / 1e-89 Tetratricopeptide repeat (TPR)-like superfamily protein (.1) Lus10025299 [exp] 113 / 2e-31 AT2G37400 272 / 3e-89 Tetratricopeptide repeat (TPR)-like superfamily protein (.1) Lus10035707 [exp] 72 / 1e-16 AT4G39470 257 / 3e-84 Tetratricopeptide repeat (TPR)-like superfamily protein (.1) Lus10035087 [exp] 61 / 3e-13 AT3G18420 133 / 6e-39 Protein prenylyltransferase superfamily protein (.1) Lus10031923 [exp] 55 / 3e-10 AT3G18420 270 / 2e-89 Protein prenylyltransferase superfamily protein (.1) Lus10034802 [exp] 43 / 5e-06 AT1G78915 440 / 2e-153 Tetratricopeptide repeat (TPR)-like superfamily protein (.1), Tetratricopeptide repeat (TPR)-like superfamily protein (.2), Tetratricopeptide repeat (TPR)-like superfamily protein (.3)
PFAM info	Clan ID Clan name Pfam ID Pfam name Pfam description CL0020 [poplar] [flax] TPR PF07719 [poplar] [flax] TPR_2 Tetratricopeptide repeat
Representative CDS sequence Show only first row Show all	>Potri.016G081200.1 pacid=42809366 polypeptide=Potri.016G081200.1.p locus=Potri.016G081200 ID=Potri.016G081200.1.v4.1 annot-version=v4.1 ATGGAGGAGAAGTATCTTGATGCATTGAAGGTTTATGAGGAGTTGGTGAAAGAGGAACCGAGGGATTTTAGGCTGTATTTGTGTCAAGGGATCATTTATA CTTTGTTGAGGAAGAAAGATGAAGCGGAGAAAAAGTTTGAGCAGTTTAAAAAGCTTGTTCCGAAGAATCATCCTTATAGGGAGTATTTGGTTGATAATAT GTTTGCTACTAAGTTCTTTTCGGACAAGGTAGAGAGGGAGAGGAGTTGA
AA sequence Show only first row Show all	>Potri.016G081200.1 pacid=42809366 polypeptide=Potri.016G081200.1.p locus=Potri.016G081200 ID=Potri.016G081200.1.v4.1 annot-version=v4.1 MEEKYLDALKVYEELVKEEPRDFRLYLCQGIIYTLLRKKDEAEKKFEQFKKLVPKNHPYREYLVDNMFATKFFSDKVERERS

---

DESeq2's median of ratios [POPLAR]

Mapped by: StringTie Salmon Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	NWA:WT	NWB:WT	NWA:OE-ARK2	NWB:OE-ARK2	NWA:miRNA-ARK2	NWB:miRNA-ARK2	NW 0hr	WT H20	WT-NW	TUA1dEY NW	TUA1dEY+TUB15 NW	TUA1dY+TUB9 NW	Pde NW	NWA:WT GA	NWBWT GA	TW:WT	TW:WT GA	NWA:OE-ARK2 GA	NWB:OE-ARK2 GA	TW:OE-ARK2	TW:OE-ARK2 GA	NWA:miRNA-ARK2 GA	NWB:miRNA-ARK2 GA	TW:miRNA-ARK2	TW:miRNA-ARK2 GA	TW 2hr	TW 8hr	TW 24hr	TW 48hr	TW 96hr	TW 336hr	WT ACC	35S::etr1-1 H20	35S::etr1-1 ACC	LMX5::etr1-1 H20	LMX5::etr1-1 ACC	WT-TW	TUA1dEY TW	TUA1dEY+TUB15 TW	TUA1dY+TUB9 TW	Pde TW	OW:WT	OW:WT GA	OW:OE-ARK2	OW:OE-ARK2 GA	OW:miRNA-ARK2	OW:miRNA-ARK2 GA	OW 2hr	OW 8hr	OW 24hr	OW 48hr	OW 96hr	OW 336hr	Root CTR	Root LongCold	Root LongDrougt	Root LongHeat	Root LongSalt	Root ShortCold	Root ShortDrougt	Root ShortHeat	Root ShortSalt	Ptr root	Leaf CTR	Leaf LongCold	Leaf LongDrougt	Leaf LongHeat	Leaf LongSalt	Leaf ShortCold	Leaf ShortDrougt	Leaf ShortHeat	Leaf ShortSalt	Ptr leaf	Stem CTR	Stem LongCold	Stem LongDrougt	Stem LongHeat	Stem LongSalt	Stem ShortCold	Stem ShortDrougt	Stem ShortHeat	Stem ShortSalt	Ptr shoot	Ptr xylem	Ptr phloem	Ptr fiber	Ptr vessel	Ptr fiber vessel ray
AT3G53560			Tetratricopeptide repeat (TPR)...		Potri.016G081200 [exp]	0	1
AT3G01790			Ribosomal protein L13 family p...		Potri.001G334000 [exp]	1.73	0.9157
AT4G34110		PABP2, PAB2, AT...	ARABIDOPSIS POLY\(A\) BINDING ...		Potri.009G099300 [exp]	2.44	0.8204
AT1G76890	Trihelix	AT-GT2, GT2	Duplicated homeodomain-like su...		Potri.018G049500 [exp]	5.29	0.8068
AT3G07930			DNA glycosylase superfamily pr...		Potri.014G189400 [exp]	23.74	0.7527
AT1G65470		NFB2, FAS1	NUCLEOSOME/CHROMATIN ASSEMBLY ...		Potri.002G209795 [exp]	26.24	0.8073
AT3G07930			DNA glycosylase superfamily pr...		Potri.014G187000 [exp]	31.60	0.7842
AT1G80620			S15/NS1, RNA-binding protein (...		Potri.003G178800 [exp]	36.46	0.7601
AT3G56510			RNA-binding (RRM/RBD/RNP motif...		Potri.001G341300 [exp]	38.00	0.7841
AT2G43780			unknown protein		Potri.019G096500 [exp]	39.23	0.8176
AT2G32230		PRORP1	proteinaceous RNase P 1 (.1)		Potri.017G144900 [exp]	40.39	0.7747

Compare expression of checked genes

Potri.016G081200 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.