Plant FIBer expression Database

Potri.016G087000 [POPLAR]


External link
JGI Phytozome v13PopgenieAspWood                  
Symbol
Arabidopsis homologues
Locus ID BLAST score/e-value TF class Alias TAIR10 short description
AT5G03120 54 / 6e-11 unknown protein
Paralogs
Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description
Potri.006G130400
[exp]
140 / 3e-45 AT5G03120 62 / 3e-14 unknown protein
Flax homologues
Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description
Lus10019921
[exp]
39 / 3e-05 ND /
PFAM info
Representative CDS sequence
>Potri.016G087000.1 pacid=42810118 polypeptide=Potri.016G087000.1.p locus=Potri.016G087000 ID=Potri.016G087000.1.v4.1 annot-version=v4.1
ATGGAGCTTAAGTCTAGCATCTCCACGGTCTTTCTTCTGTTCCTCCTCCTTGTCACACCTCACATTTCTAGAGGAGGATCTGAAGTGGCAGATTCAGAGG
TTTATGAAATTGATTATAGAGGACCAGAGACTCACTCGTCAGTTATGCCTCCTCCTGGCCATTTTCATGGCAGGCCTTGGATTCATCAAGATACTGTCAA
GACATCTCATAAACCCCAAGGTTTCAGAGGTGGTAACAACGGAGAACAAGCTAAAAAAATTCATGGATGA
AA sequence
>Potri.016G087000.1 pacid=42810118 polypeptide=Potri.016G087000.1.p locus=Potri.016G087000 ID=Potri.016G087000.1.v4.1 annot-version=v4.1
MELKSSISTVFLLFLLLVTPHISRGGSEVADSEVYEIDYRGPETHSSVMPPPGHFHGRPWIHQDTVKTSHKPQGFRGGNNGEQAKKIHG

DESeq2's median of ratios [POPLAR]

Mapped by: Order by: Show schematic diagram

Coexpressed genes

Only top 10 genes are shown Show allDownload tab-delimited text
Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.
At best At TF class At alias At description Locus MR r Symbol NWA:WTNWB:WTNWA:OE-ARK2NWB:OE-ARK2NWA:miRNA-ARK2NWB:miRNA-ARK2NW 0hrWT H20WT-NWTUA1dEY NWTUA1dEY+TUB15 NWTUA1dY+TUB9 NWPde NWNWA:WT GANWBWT GATW:WTTW:WT GANWA:OE-ARK2 GANWB:OE-ARK2 GATW:OE-ARK2TW:OE-ARK2 GANWA:miRNA-ARK2 GANWB:miRNA-ARK2 GATW:miRNA-ARK2TW:miRNA-ARK2 GATW 2hrTW 8hrTW 24hrTW 48hrTW 96hrTW 336hrWT ACC35S::etr1-1 H2035S::etr1-1 ACCLMX5::etr1-1 H20LMX5::etr1-1 ACCWT-TWTUA1dEY TWTUA1dEY+TUB15 TWTUA1dY+TUB9 TWPde TWOW:WTOW:WT GAOW:OE-ARK2OW:OE-ARK2 GAOW:miRNA-ARK2OW:miRNA-ARK2 GAOW 2hrOW 8hrOW 24hrOW 48hrOW 96hrOW 336hrRoot CTRRoot LongColdRoot LongDrougtRoot LongHeatRoot LongSaltRoot ShortColdRoot ShortDrougtRoot ShortHeatRoot ShortSaltPtr rootLeaf CTRLeaf LongColdLeaf LongDrougtLeaf LongHeatLeaf LongSaltLeaf ShortColdLeaf ShortDrougtLeaf ShortHeatLeaf ShortSaltPtr leafStem CTRStem LongColdStem LongDrougtStem LongHeatStem LongSaltStem ShortColdStem ShortDrougtStem ShortHeatStem ShortSaltPtr shootPtr xylemPtr phloemPtr fiberPtr vesselPtr fiber vessel ray
AT5G03120 unknown protein Potri.016G087000
[exp]
0 1
Potri.004G047866
[exp]
5.29 0.8369
AT2G38500 2-oxoglutarate (2OG) and Fe(II... Potri.016G134500
[exp]
11.78 0.8586
AT3G47570 Leucine-rich repeat protein ki... Potri.008G034000
[exp]
12.60 0.8499
AT3G06350 EMB3004, MEE32 MATERNAL EFFECT EMBRYO ARREST ... Potri.010G019000
[exp]
14.00 0.8427
AT1G12500 Nucleotide-sugar transporter f... Potri.003G118000
[exp]
14.49 0.8517
AT5G15710 Galactose oxidase/kelch repeat... Potri.017G102300
[exp]
26.55 0.7870
AT1G17745 PGDH D-3-phosphoglycerate dehydroge... Potri.010G249600
[exp]
29.12 0.8310
AT4G28500 NAC ANAC073, SND2, ... SECONDARY WALL-ASSOCIATED NAC ... Potri.007G135300
[exp]
32.09 0.8402
AT1G11860 Glycine cleavage T-protein fam... Potri.004G009600
[exp]
33.94 0.8298 GDCST.2
AT1G32050 SCAMP family protein (.1) Potri.003G099300
[exp]
34.74 0.7758

Potri.016G087000 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.