Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser] Popgenie AspWood
Symbol	Pt-SUBI.1
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT4G05050 206 / 4e-70 UBQ11 ubiquitin 11 (.1.2.3.4) AT5G03240 209 / 3e-69 UBQ3 polyubiquitin 3 (.1.2.3) AT4G02890 207 / 4e-69 UBQ14 Ubiquitin family protein (.1.2.3.4) AT1G55060 206 / 4e-69 UBQ12 ubiquitin 12 (.1) AT5G20620 210 / 2e-68 UBQ4 ubiquitin 4 (.1) AT4G05320 207 / 3e-68 UBQ10 polyubiquitin 10 (.1.2.3.4.5.6) AT1G65350 199 / 4e-65 UBQ13 ubiquitin 13 (.1) AT5G37640 195 / 3e-63 UBQ9 ubiquitin 9 (.1) AT3G09790 193 / 1e-59 UBQ8 ubiquitin 8 (.1) AT1G31340 159 / 3e-51 NEDD8, ATRUB1, RUB1 ARABIDOPSIS THALIANA RELATED TO UBIQUITIN 1, related to ubiquitin 1 (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.006G129600 [exp] 212 / 4e-70 AT5G20620 600 / 0.0 ubiquitin 4 (.1) Potri.011G026600 [exp] 207 / 4e-69 AT4G05050 452 / 3e-164 ubiquitin 11 (.1.2.3.4) Potri.017G135600 [exp] 208 / 8e-69 AT4G02890 597 / 0.0 Ubiquitin family protein (.1.2.3.4) Potri.004G021500 [exp] 207 / 3e-68 AT4G02890 604 / 0.0 Ubiquitin family protein (.1.2.3.4) Potri.007G123300 [exp] 207 / 3e-67 AT4G05320 753 / 0.0 polyubiquitin 10 (.1.2.3.4.5.6) Potri.001G263000 [exp] 207 / 3e-67 AT4G05320 752 / 0.0 polyubiquitin 10 (.1.2.3.4.5.6) Potri.001G418500 [exp] 207 / 3e-67 AT4G05320 753 / 0.0 polyubiquitin 10 (.1.2.3.4.5.6) Potri.017G036800 [exp] 207 / 3e-67 AT4G05320 753 / 0.0 polyubiquitin 10 (.1.2.3.4.5.6) Potri.011G134200 [exp] 207 / 4e-66 AT4G05320 900 / 0.0 polyubiquitin 10 (.1.2.3.4.5.6)
Flax homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10018367 [exp] 207 / 4e-69 AT4G05320 452 / 4e-164 polyubiquitin 10 (.1.2.3.4.5.6) Lus10008873 [exp] 120 / 3e-36 AT3G52590 261 / 5e-92 HAPLESS 4, EARLY-RESPONSIVE TO DEHYDRATION 16, EMBRYO DEFECTIVE 2167, ubiquitin extension protein 1 (.1) Lus10030894 [exp] 119 / 2e-35 AT2G47110 257 / 3e-89 ubiquitin 6 (.1.2) Lus10030595 [exp] 119 / 2e-35 AT2G47110 257 / 3e-89 ubiquitin 6 (.1.2) Lus10018104 [exp] 56 / 5e-10 AT5G24240 689 / 0.0 Phosphatidylinositol 3- and 4-kinase ;Ubiquitin family protein (.1) Lus10022411 [exp] 50 / 3e-08 AT5G24240 731 / 0.0 Phosphatidylinositol 3- and 4-kinase ;Ubiquitin family protein (.1) Lus10018538 [exp] 47 / 7e-08 AT2G35635 51 / 6e-09 RELATED TO UBIQUITIN 2, ubiquitin 7 (.1) Lus10010493 [exp] 47 / 6e-07 AT4G12570 830 / 0.0 ubiquitin protein ligase 5 (.1) Lus10034563 [exp] 43 / 1e-05 AT5G42220 444 / 3e-148 Ubiquitin-like superfamily protein (.1) Lus10040001 [exp] 43 / 2e-05 AT5G25270 328 / 3e-102 Ubiquitin-like superfamily protein (.1)
PFAM info	Clan ID Clan name Pfam ID Pfam name Pfam description CL0072 [poplar] [flax] Ubiquitin PF00240 [poplar] [flax] ubiquitin Ubiquitin family
Representative CDS sequence Show only first row Show all	>Potri.016G088100.1 pacid=42810206 polypeptide=Potri.016G088100.1.p locus=Potri.016G088100 ID=Potri.016G088100.1.v4.1 annot-version=v4.1 ATGGAAGGAATCCCTCCAGATCAGCAGAGGCTAATCTTTGCAGGGAAGCAGCTAGAAGATGGAAGGACCCTTGCTGATTATAATATTCAAAAGGAGTCTA CTCTTCATCTGGTGCTGCGTTTAAGAGGAGGGATACAAATATTTGTCAAGACCCTAACAGGAAAGACAATTACCCTTGAGGTCGAGAGCTCTGATACAAT AGACAACGTGAAAACCAAGAATCAAGATCAGCAGAGGCTTATCTTTGCTGGGAAGCAATTGGAGGATGGGAGAACTCTTGCGGATTATAATGTTCAGAAG GAGTCTACTTTCCATCTCGTGCTCCGTCCTCGTGGTGGTGATTTCTGA
AA sequence Show only first row Show all	>Potri.016G088100.1 pacid=42810206 polypeptide=Potri.016G088100.1.p locus=Potri.016G088100 ID=Potri.016G088100.1.v4.1 annot-version=v4.1 MEGIPPDQQRLIFAGKQLEDGRTLADYNIQKESTLHLVLRLRGGIQIFVKTLTGKTITLEVESSDTIDNVKTKNQDQQRLIFAGKQLEDGRTLADYNVQK ESTFHLVLRPRGGDF

---

DESeq2's median of ratios [POPLAR]

Mapped by: StringTie Salmon Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	NWA:WT	NWB:WT	NWA:OE-ARK2	NWB:OE-ARK2	NWA:miRNA-ARK2	NWB:miRNA-ARK2	NW 0hr	WT H20	WT-NW	TUA1dEY NW	TUA1dEY+TUB15 NW	TUA1dY+TUB9 NW	Pde NW	NWA:WT GA	NWBWT GA	TW:WT	TW:WT GA	NWA:OE-ARK2 GA	NWB:OE-ARK2 GA	TW:OE-ARK2	TW:OE-ARK2 GA	NWA:miRNA-ARK2 GA	NWB:miRNA-ARK2 GA	TW:miRNA-ARK2	TW:miRNA-ARK2 GA	TW 2hr	TW 8hr	TW 24hr	TW 48hr	TW 96hr	TW 336hr	WT ACC	35S::etr1-1 H20	35S::etr1-1 ACC	LMX5::etr1-1 H20	LMX5::etr1-1 ACC	WT-TW	TUA1dEY TW	TUA1dEY+TUB15 TW	TUA1dY+TUB9 TW	Pde TW	OW:WT	OW:WT GA	OW:OE-ARK2	OW:OE-ARK2 GA	OW:miRNA-ARK2	OW:miRNA-ARK2 GA	OW 2hr	OW 8hr	OW 24hr	OW 48hr	OW 96hr	OW 336hr	Root CTR	Root LongCold	Root LongDrougt	Root LongHeat	Root LongSalt	Root ShortCold	Root ShortDrougt	Root ShortHeat	Root ShortSalt	Ptr root	Leaf CTR	Leaf LongCold	Leaf LongDrougt	Leaf LongHeat	Leaf LongSalt	Leaf ShortCold	Leaf ShortDrougt	Leaf ShortHeat	Leaf ShortSalt	Ptr leaf	Stem CTR	Stem LongCold	Stem LongDrougt	Stem LongHeat	Stem LongSalt	Stem ShortCold	Stem ShortDrougt	Stem ShortHeat	Stem ShortSalt	Ptr shoot	Ptr xylem	Ptr phloem	Ptr fiber	Ptr vessel	Ptr fiber vessel ray
AT4G05050		UBQ11	ubiquitin 11 (.1.2.3.4)		Potri.016G088100 [exp]	0	1	Pt-SUBI.1
AT3G14690		CYP72A15	"cytochrome P450, family 72, s...		Potri.011G101700 [exp]	9.79	0.6308
					Potri.001G241254 [exp]	15.87	0.5925
AT1G72550			tRNA synthetase beta subunit f...		Potri.013G068100 [exp]	30.00	0.6052
AT4G32560			paramyosin-related (.1.2.3)		Potri.006G247900 [exp]	30.46	0.6042
AT1G17180		ATGSTU25	glutathione S-transferase TAU ...		Potri.011G112900 [exp]	44.39	0.5763
AT5G53480			ARM repeat superfamily protein...		Potri.012G017500 [exp]	47.71	0.5400
AT3G14690		CYP72A15	"cytochrome P450, family 72, s...		Potri.011G101250 [exp]	58.30	0.5432
AT3G43660			Vacuolar iron transporter (VIT...		Potri.018G106000 [exp]	69.28	0.5926
AT4G26400			RING/U-box superfamily protein...		Potri.017G038300 [exp]	77.92	0.5901
AT4G13850		ATGRP2, GR-RBP2	glycine rich protein 2, glycin...		Potri.001G236300 [exp]	96.14	0.5453

Compare expression of checked genes

Potri.016G088100 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.