Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser] Popgenie AspWood
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT2G37195 132 / 9e-41 unknown protein
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.006G127800 [exp] 243 / 8e-85 AT2G37195 134 / 1e-41 unknown protein
Flax homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10023187 [exp] 216 / 1e-73 AT2G37195 129 / 5e-39 unknown protein Lus10002229 [exp] 211 / 5e-72 AT2G37195 132 / 1e-40 unknown protein Lus10026508 [exp] 210 / 2e-71 AT2G37195 123 / 3e-37 unknown protein Lus10019937 [exp] 173 / 2e-56 AT2G37195 103 / 1e-28 unknown protein Lus10019376 [exp] 39 / 0.0005 AT1G06070 384 / 6e-131 Basic-leucine zipper (bZIP) transcription factor family protein (.1)
PFAM info
Representative CDS sequence Show only first row Show all	>Potri.016G090000.1 pacid=42809856 polypeptide=Potri.016G090000.1.p locus=Potri.016G090000 ID=Potri.016G090000.1.v4.1 annot-version=v4.1 ATGGGAGGTGAAAGGAAGAGGATATTGGTGGGTCTTATGGTGGCAATGATTTTGGGAATTGCAGTATACTTCAGGCTTTGGACAATTGACTATGCTATCT CCTCTGATGACACTGAGTTGATAAGAAGACAGTTTGATCTTGCCAATAGGGAAGCATTGGATGAATCTGCAGAGTGGAGGATGAAATATGATGAAGAGGT AGAGAGATCTGCCAAGTGTGATAAGCAATTGATAGAGATAAAGCAGAAAGTGGAGGATGCTGCAAGTATTAACCAACAATTGGTAATGCTACAGAAGGAA AACATGGCCCTGGTTGGAAGGATGGAAGTCTTAAAAAGAGAGCTGGAGGCTACAAAGTTAAAGTGTCGCTCAAAAATAGACAGGTGA
AA sequence Show only first row Show all	>Potri.016G090000.1 pacid=42809856 polypeptide=Potri.016G090000.1.p locus=Potri.016G090000 ID=Potri.016G090000.1.v4.1 annot-version=v4.1 MGGERKRILVGLMVAMILGIAVYFRLWTIDYAISSDDTELIRRQFDLANREALDESAEWRMKYDEEVERSAKCDKQLIEIKQKVEDAASINQQLVMLQKE NMALVGRMEVLKRELEATKLKCRSKIDR

---

DESeq2's median of ratios [POPLAR]

Mapped by: StringTie Salmon Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	NWA:WT	NWB:WT	NWA:OE-ARK2	NWB:OE-ARK2	NWA:miRNA-ARK2	NWB:miRNA-ARK2	NW 0hr	WT H20	WT-NW	TUA1dEY NW	TUA1dEY+TUB15 NW	TUA1dY+TUB9 NW	Pde NW	NWA:WT GA	NWBWT GA	TW:WT	TW:WT GA	NWA:OE-ARK2 GA	NWB:OE-ARK2 GA	TW:OE-ARK2	TW:OE-ARK2 GA	NWA:miRNA-ARK2 GA	NWB:miRNA-ARK2 GA	TW:miRNA-ARK2	TW:miRNA-ARK2 GA	TW 2hr	TW 8hr	TW 24hr	TW 48hr	TW 96hr	TW 336hr	WT ACC	35S::etr1-1 H20	35S::etr1-1 ACC	LMX5::etr1-1 H20	LMX5::etr1-1 ACC	WT-TW	TUA1dEY TW	TUA1dEY+TUB15 TW	TUA1dY+TUB9 TW	Pde TW	OW:WT	OW:WT GA	OW:OE-ARK2	OW:OE-ARK2 GA	OW:miRNA-ARK2	OW:miRNA-ARK2 GA	OW 2hr	OW 8hr	OW 24hr	OW 48hr	OW 96hr	OW 336hr	Root CTR	Root LongCold	Root LongDrougt	Root LongHeat	Root LongSalt	Root ShortCold	Root ShortDrougt	Root ShortHeat	Root ShortSalt	Ptr root	Leaf CTR	Leaf LongCold	Leaf LongDrougt	Leaf LongHeat	Leaf LongSalt	Leaf ShortCold	Leaf ShortDrougt	Leaf ShortHeat	Leaf ShortSalt	Ptr leaf	Stem CTR	Stem LongCold	Stem LongDrougt	Stem LongHeat	Stem LongSalt	Stem ShortCold	Stem ShortDrougt	Stem ShortHeat	Stem ShortSalt	Ptr shoot	Ptr xylem	Ptr phloem	Ptr fiber	Ptr vessel	Ptr fiber vessel ray
AT2G37195			unknown protein		Potri.016G090000 [exp]	0	1
AT2G47500			P-loop nucleoside triphosphate...		Potri.014G125700 [exp]	2.00	0.9142
AT1G74690		IQD31	IQ-domain 31 (.1)		Potri.012G069900 [exp]	3.16	0.9121
AT5G25170			PPPDE putative thiol peptidase...		Potri.018G021700 [exp]	6.48	0.8552
AT5G09400		KUP7	K+ uptake permease 7, K+ uptak...		Potri.003G023900 [exp]	12.24	0.8745	Pt-KUP7.2
AT3G01390		AVMA10, VMA10	vacuolar membrane ATPase 10 (....		Potri.010G222000 [exp]	12.24	0.8855	VMA10.2
AT5G10270		CDKC;1	cyclin-dependent kinase C;1 (....		Potri.006G024600 [exp]	13.19	0.8486	Pt-CDC2.5
AT5G06610			Protein of unknown function (D...		Potri.006G196800 [exp]	14.00	0.8679
AT5G50000			Protein kinase superfamily pro...		Potri.015G074400 [exp]	15.09	0.8706
AT5G57330			Galactose mutarotase-like supe...		Potri.006G165400 [exp]	16.00	0.8782
AT2G26850			F-box family protein (.1)		Potri.016G035900 [exp]	16.73	0.8326

Compare expression of checked genes

Potri.016G090000 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.