Pt-PSRP4.1 (Potri.016G113700) [POPLAR]


External link
JGI Phytozome v13PopgenieAspWood                  
Symbol Pt-PSRP4.1
Arabidopsis homologues
Locus ID BLAST score/e-value TF class Alias TAIR10 short description
AT2G38140 72 / 1e-17 PSRP4 plastid-specific ribosomal protein 4 (.1)
Paralogs
Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description
Potri.009G124700 42 / 4e-06 AT2G21290 45 / 1e-07 unknown protein
Potri.004G163100 39 / 9e-05 AT2G21290 41 / 6e-06 unknown protein
Flax homologues
Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description
Lus10002497 57 / 1e-11 AT2G38140 72 / 2e-17 plastid-specific ribosomal protein 4 (.1)
Lus10004829 46 / 3e-07 AT2G38140 70 / 2e-16 plastid-specific ribosomal protein 4 (.1)
PFAM info
Clan ID Clan name Pfam ID Pfam name Pfam description
PF17067 RPS31 Ribosomal protein S31e
Representative CDS sequence
>Potri.016G113700.1 pacid=42809182 polypeptide=Potri.016G113700.1.p locus=Potri.016G113700 ID=Potri.016G113700.1.v4.1 annot-version=v4.1
ATGGCTTCACTCATGGTGGGTGCTATCCCTATGACCCCTCAAGCTCTCAACTTTGGCTCTCGCCTGTCTTATTCTCAATCGCAAATCTCTCTTTGCCATT
CAACCTCTTCACTTCCACTCTCCACCGCCAGAACTTCAGTCCCATTTGTGTACTGTGGAAGAGGGGACAGGAAGACTGAAAGAGGGAAAAGATTCAACCA
CTCATTTGGAAACGCGAGGCCTAGGGATAAGAAGAAAGGGAGAGGACCACCAAGAATACCAGTTCCTGGTGCTCCACCTAAGATAGATAAGTCTGTTGAT
GATGAGGTTGTCAAGATTGAAATTGATGAGTCGCTTGGTTAA
AA sequence
>Potri.016G113700.1 pacid=42809182 polypeptide=Potri.016G113700.1.p locus=Potri.016G113700 ID=Potri.016G113700.1.v4.1 annot-version=v4.1
MASLMVGAIPMTPQALNFGSRLSYSQSQISLCHSTSSLPLSTARTSVPFVYCGRGDRKTERGKRFNHSFGNARPRDKKKGRGPPRIPVPGAPPKIDKSVD
DEVVKIEIDESLG

DESeq2's median of ratios [POPLAR]

Mapped by: Order by: Show schematic diagram

Coexpressed genes

Only top 10 genes are shown Show allDownload tab-delimited text
Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.
At best At TF class At alias At description Locus MR r Symbol NWA:WTNWB:WTNWA:OE-ARK2NWB:OE-ARK2NWA:miRNA-ARK2NWB:miRNA-ARK2NW 0hrWT H20WT-NWTUA1dEY NWTUA1dEY+TUB15 NWTUA1dY+TUB9 NWPde NWNWA:WT GANWBWT GATW:WTTW:WT GANWA:OE-ARK2 GANWB:OE-ARK2 GATW:OE-ARK2TW:OE-ARK2 GANWA:miRNA-ARK2 GANWB:miRNA-ARK2 GATW:miRNA-ARK2TW:miRNA-ARK2 GATW 2hrTW 8hrTW 24hrTW 48hrTW 96hrTW 336hrWT ACC35S::etr1-1 H2035S::etr1-1 ACCLMX5::etr1-1 H20LMX5::etr1-1 ACCWT-TWTUA1dEY TWTUA1dEY+TUB15 TWTUA1dY+TUB9 TWPde TWOW:WTOW:WT GAOW:OE-ARK2OW:OE-ARK2 GAOW:miRNA-ARK2OW:miRNA-ARK2 GAOW 2hrOW 8hrOW 24hrOW 48hrOW 96hrOW 336hrRoot CTRRoot LongColdRoot LongDrougtRoot LongHeatRoot LongSaltRoot ShortColdRoot ShortDrougtRoot ShortHeatRoot ShortSaltPtr rootLeaf CTRLeaf LongColdLeaf LongDrougtLeaf LongHeatLeaf LongSaltLeaf ShortColdLeaf ShortDrougtLeaf ShortHeatLeaf ShortSaltPtr leafStem CTRStem LongColdStem LongDrougtStem LongHeatStem LongSaltStem ShortColdStem ShortDrougtStem ShortHeatStem ShortSaltPtr shootPtr xylemPtr phloemPtr fiberPtr vesselPtr fiber vessel ray
AT2G38140 PSRP4 plastid-specific ribosomal pro... Potri.016G113700 0 1 Pt-PSRP4.1
AT3G47070 unknown protein Potri.009G043600 1.73 0.9775
AT4G34620 SSR16 small subunit ribosomal protei... Potri.013G128200 3.00 0.9733
AT1G35680 RPL21C chloroplast ribosomal protein ... Potri.019G083400 3.16 0.9766 Pt-RPL21.3
AT4G30845 unknown protein Potri.006G180200 3.46 0.9721
AT3G25920 RPL15 ribosomal protein L15 (.1) Potri.008G121100 6.32 0.9711
AT3G14930 HEME1 Uroporphyrinogen decarboxylase... Potri.001G390800 8.36 0.9683
AT5G52100 CRR1 chlororespiration reduction 1,... Potri.015G135400 10.24 0.9612
AT5G58250 EMB3143 EMBRYO DEFECTIVE 3143, unknown... Potri.013G161000 10.39 0.9635
AT1G51400 Photosystem II 5 kD protein (.... Potri.001G256900 12.36 0.9627
AT3G23760 unknown protein Potri.015G108200 12.96 0.9672

Potri.016G113700 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.