Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser] Popgenie AspWood
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT5G59310 92 / 2e-25 LTP4 lipid transfer protein 4 (.1) AT3G51600 86 / 1e-22 LTP5 lipid transfer protein 5 (.1) AT5G59320 84 / 3e-22 LTP3 lipid transfer protein 3 (.1) AT2G38530 80 / 2e-20 cdf3, LP2, LTP2 cell growth defect factor-3, lipid transfer protein 2 (.1) AT2G38540 78 / 9e-20 ATLTP1, LP1 ARABIDOPSIS THALIANA LIPID TRANSFER PROTEIN 1, lipid transfer protein 1 (.1) AT3G51590 73 / 1e-17 LTP12 lipid transfer protein 12 (.1) AT2G15050 68 / 1e-15 LTP7, LTP lipid transfer protein 7, lipid transfer protein (.1.2.3) AT2G18370 62 / 2e-13 Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein (.1) AT5G01870 61 / 4e-13 Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein (.1) AT3G08770 60 / 1e-12 LTP6 lipid transfer protein 6 (.1.2)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.016G135500 [exp] 162 / 3e-53 AT5G59320 94 / 8e-26 lipid transfer protein 3 (.1) Potri.016G135400 [exp] 103 / 1e-29 AT5G59320 109 / 3e-32 lipid transfer protein 3 (.1) Potri.006G108100 [exp] 99 / 8e-28 AT2G38540 121 / 6e-37 ARABIDOPSIS THALIANA LIPID TRANSFER PROTEIN 1, lipid transfer protein 1 (.1) Potri.004G086500 [exp] 81 / 5e-21 AT2G38540 124 / 5e-38 ARABIDOPSIS THALIANA LIPID TRANSFER PROTEIN 1, lipid transfer protein 1 (.1) Potri.004G086600 [exp] 80 / 1e-20 AT2G38540 122 / 3e-37 ARABIDOPSIS THALIANA LIPID TRANSFER PROTEIN 1, lipid transfer protein 1 (.1) Potri.011G021900 [exp] 75 / 2e-18 AT3G08770 60 / 8e-13 lipid transfer protein 6 (.1.2) Potri.016G136000 [exp] 72 / 2e-17 AT5G01870 113 / 1e-33 Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein (.1) Potri.001G232700 [exp] 72 / 2e-17 AT2G18370 93 / 1e-25 Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein (.1) Potri.001G232900 [exp] 72 / 3e-17 AT2G18370 100 / 3e-28 Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein (.1)
Flax homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10026418 [exp] 80 / 3e-20 AT5G59320 115 / 2e-34 lipid transfer protein 3 (.1) Lus10012384 [exp] 77 / 2e-19 AT5G59310 76 / 4e-19 lipid transfer protein 4 (.1) Lus10028055 [exp] 73 / 1e-17 AT5G59310 66 / 9e-15 lipid transfer protein 4 (.1) Lus10007280 [exp] 72 / 2e-17 AT5G59310 90 / 2e-24 lipid transfer protein 4 (.1) Lus10012383 [exp] 72 / 3e-17 AT5G59310 64 / 4e-14 lipid transfer protein 4 (.1) Lus10028003 [exp] 72 / 4e-17 AT5G59310 64 / 3e-14 lipid transfer protein 4 (.1) Lus10028002 [exp] 72 / 4e-17 AT5G59310 64 / 3e-14 lipid transfer protein 4 (.1) Lus10015278 [exp] 71 / 9e-17 AT5G59310 110 / 1e-32 lipid transfer protein 4 (.1) Lus10022745 [exp] 71 / 1e-16 AT5G59310 103 / 1e-29 lipid transfer protein 4 (.1) Lus10029226 [exp] 70 / 1e-16 AT5G59310 94 / 3e-26 lipid transfer protein 4 (.1)
PFAM info	Clan ID Clan name Pfam ID Pfam name Pfam description CL0482 [poplar] [flax] Prolamin PF00234 [poplar] [flax] Tryp_alpha_amyl Protease inhibitor/seed storage/LTP family
Representative CDS sequence Show only first row Show all	>Potri.016G135700.1 pacid=42809285 polypeptide=Potri.016G135700.1.p locus=Potri.016G135700 ID=Potri.016G135700.1.v4.1 annot-version=v4.1 ATGGCTAATGCTAAGCTGATCTGTGCTCTCTTGCTATGCATACTGGTCACTGCCCCCATGTTGAACATTGAAGCCTCGATAAGATGTCATACTGTGAAAG GTAACTTGGAAACGTGCCTTGGCTACTTTACGAAGGTTGAAACTGTTCCTCCGCCCGGTTGCTGCAGAGGAGTTCAGAATGTCAACAACGCTGCTAGAAC CACCAAGGAACGCCGAGACACTTGTAGTTGCTTGAAAACAGTTGCCAAACAGTATCATGTCAATCTCACGTTCGCAGCTGATCTCCCTCGCATCTGCAAA GTTAAAATTCCTTACCCTATTAGCGCCTCCATTGACTGCTCCAGGATTAAGTGA
AA sequence Show only first row Show all	>Potri.016G135700.1 pacid=42809285 polypeptide=Potri.016G135700.1.p locus=Potri.016G135700 ID=Potri.016G135700.1.v4.1 annot-version=v4.1 MANAKLICALLLCILVTAPMLNIEASIRCHTVKGNLETCLGYFTKVETVPPPGCCRGVQNVNNAARTTKERRDTCSCLKTVAKQYHVNLTFAADLPRICK VKIPYPISASIDCSRIK

---

DESeq2's median of ratios [POPLAR]

Mapped by: StringTie Salmon Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	NWA:WT	NWB:WT	NWA:OE-ARK2	NWB:OE-ARK2	NWA:miRNA-ARK2	NWB:miRNA-ARK2	NW 0hr	WT H20	WT-NW	TUA1dEY NW	TUA1dEY+TUB15 NW	TUA1dY+TUB9 NW	Pde NW	NWA:WT GA	NWBWT GA	TW:WT	TW:WT GA	NWA:OE-ARK2 GA	NWB:OE-ARK2 GA	TW:OE-ARK2	TW:OE-ARK2 GA	NWA:miRNA-ARK2 GA	NWB:miRNA-ARK2 GA	TW:miRNA-ARK2	TW:miRNA-ARK2 GA	TW 2hr	TW 8hr	TW 24hr	TW 48hr	TW 96hr	TW 336hr	WT ACC	35S::etr1-1 H20	35S::etr1-1 ACC	LMX5::etr1-1 H20	LMX5::etr1-1 ACC	WT-TW	TUA1dEY TW	TUA1dEY+TUB15 TW	TUA1dY+TUB9 TW	Pde TW	OW:WT	OW:WT GA	OW:OE-ARK2	OW:OE-ARK2 GA	OW:miRNA-ARK2	OW:miRNA-ARK2 GA	OW 2hr	OW 8hr	OW 24hr	OW 48hr	OW 96hr	OW 336hr	Root CTR	Root LongCold	Root LongDrougt	Root LongHeat	Root LongSalt	Root ShortCold	Root ShortDrougt	Root ShortHeat	Root ShortSalt	Ptr root	Leaf CTR	Leaf LongCold	Leaf LongDrougt	Leaf LongHeat	Leaf LongSalt	Leaf ShortCold	Leaf ShortDrougt	Leaf ShortHeat	Leaf ShortSalt	Ptr leaf	Stem CTR	Stem LongCold	Stem LongDrougt	Stem LongHeat	Stem LongSalt	Stem ShortCold	Stem ShortDrougt	Stem ShortHeat	Stem ShortSalt	Ptr shoot	Ptr xylem	Ptr phloem	Ptr fiber	Ptr vessel	Ptr fiber vessel ray
AT5G59310		LTP4	lipid transfer protein 4 (.1)		Potri.016G135700 [exp]	0	1
AT1G11600		CYP77B1	"cytochrome P450, family 77, s...		Potri.004G019000 [exp]	2.00	0.9989
AT3G11210			SGNH hydrolase-type esterase s...		Potri.016G115800 [exp]	2.44	0.9964	CPRD49.1
AT3G26040			HXXXD-type acyl-transferase fa...		Potri.019G001200 [exp]	2.44	0.9975
AT1G56580		SVB	SMALLER WITH VARIABLE BRANCHES...		Potri.013G007000 [exp]	3.46	0.9972
AT1G75280			NmrA-like negative transcripti...		Potri.013G103701 [exp]	6.00	0.9933
AT4G23430		AtTic32-IVa	translocon at the inner envelo...		Potri.012G143600 [exp]	7.41	0.9972
AT1G22640	MYB	AtMYB3	ARABIDOPSIS THALIANA MYB DOMA...		Potri.006G275900 [exp]	7.48	0.9943
AT5G02890			HXXXD-type acyl-transferase fa...		Potri.003G082100 [exp]	8.36	0.9964
					Potri.006G027800 [exp]	8.48	0.9963
AT2G10940			Bifunctional inhibitor/lipid-t...		Potri.006G065500 [exp]	9.38	0.9951

Compare expression of checked genes

Potri.016G135700 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.