Plant FIBer expression Database

Potri.017G031150 [POPLAR]


External link
JGI Phytozome v13PopgenieAspWood                  
Symbol
Arabidopsis homologues

No hit found

Paralogs
Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description
Potri.017G030900
[exp]
64 / 1e-14 AT1G05910 1494 / 0.0 cell division cycle protein 48-related / CDC48-related (.1)
Potri.007G127900
[exp]
45 / 6e-08 AT1G05910 1351 / 0.0 cell division cycle protein 48-related / CDC48-related (.1)
Flax homologues

No hit found
PFAM info
Representative CDS sequence
>Potri.017G031150.1 pacid=42813705 polypeptide=Potri.017G031150.1.p locus=Potri.017G031150 ID=Potri.017G031150.1.v4.1 annot-version=v4.1
ATGGTGCATCCTTGGTATTTCCCCATCGTTCAGCCTATCAAGTGGGGAAACCATCAACTGAAAACAGATCTTTGTTCTTTGACCGTTTAA
AA sequence
>Potri.017G031150.1 pacid=42813705 polypeptide=Potri.017G031150.1.p locus=Potri.017G031150 ID=Potri.017G031150.1.v4.1 annot-version=v4.1
MVHPWYFPIVQPIKWGNHQLKTDLCSLTV

DESeq2's median of ratios [POPLAR]

Mapped by: Order by: Show schematic diagram

Coexpressed genes

Only top 10 genes are shown Show allDownload tab-delimited text
Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.
At best At TF class At alias At description Locus MR r Symbol NWA:WTNWB:WTNWA:OE-ARK2NWB:OE-ARK2NWA:miRNA-ARK2NWB:miRNA-ARK2NW 0hrWT H20WT-NWTUA1dEY NWTUA1dEY+TUB15 NWTUA1dY+TUB9 NWPde NWNWA:WT GANWBWT GATW:WTTW:WT GANWA:OE-ARK2 GANWB:OE-ARK2 GATW:OE-ARK2TW:OE-ARK2 GANWA:miRNA-ARK2 GANWB:miRNA-ARK2 GATW:miRNA-ARK2TW:miRNA-ARK2 GATW 2hrTW 8hrTW 24hrTW 48hrTW 96hrTW 336hrWT ACC35S::etr1-1 H2035S::etr1-1 ACCLMX5::etr1-1 H20LMX5::etr1-1 ACCWT-TWTUA1dEY TWTUA1dEY+TUB15 TWTUA1dY+TUB9 TWPde TWOW:WTOW:WT GAOW:OE-ARK2OW:OE-ARK2 GAOW:miRNA-ARK2OW:miRNA-ARK2 GAOW 2hrOW 8hrOW 24hrOW 48hrOW 96hrOW 336hrRoot CTRRoot LongColdRoot LongDrougtRoot LongHeatRoot LongSaltRoot ShortColdRoot ShortDrougtRoot ShortHeatRoot ShortSaltPtr rootLeaf CTRLeaf LongColdLeaf LongDrougtLeaf LongHeatLeaf LongSaltLeaf ShortColdLeaf ShortDrougtLeaf ShortHeatLeaf ShortSaltPtr leafStem CTRStem LongColdStem LongDrougtStem LongHeatStem LongSaltStem ShortColdStem ShortDrougtStem ShortHeatStem ShortSaltPtr shootPtr xylemPtr phloemPtr fiberPtr vesselPtr fiber vessel ray
AT1G05910 cell division cycle protein 48... Potri.017G031150
[exp]
0 1
AT4G19610 nucleotide binding;nucleic aci... Potri.001G081000
[exp]
2.82 0.9163
AT3G07330 ATCSLC6, ATCSLC... CELLULOSE-SYNTHASE LIKE C6, Ce... Potri.014G190701
[exp]
7.34 0.9000
AT1G09020 ATSNF4, SNF4 homolog of yeast sucrose nonfe... Potri.005G029300
[exp]
9.59 0.8890 Pt-SNF4.2
AT1G16780 AtVHP2;2, AVPL1 Inorganic H pyrophosphatase fa... Potri.008G003502
[exp]
10.39 0.8968
AT1G79580 NAC ANAC033, SMB, N... NAC (No Apical Meristem) domai... Potri.019G063000
[exp]
10.77 0.8837
AT5G17770 CBR1, ATCBR NADH:cytochrome B5 reductase 1... Potri.007G072750
[exp]
11.66 0.9116
AT5G42920 AtTHO5 THO complex, subunit 5 (.1.2) Potri.002G125300
[exp]
11.83 0.9094
AT3G04830 Protein prenylyltransferase su... Potri.013G038501
[exp]
21.56 0.8933
AT3G19090 RNA-binding protein (.1) Potri.009G106500
[exp]
22.04 0.8844
AT4G16340 SPK1 SPIKE1, guanyl-nucleotide exch... Potri.004G000750
[exp]
23.36 0.8963

Potri.017G031150 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.