Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser] Popgenie AspWood
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT4G15248 100 / 4e-28 CO B-box type zinc finger family protein (.1) AT3G21890 99 / 7e-28 CO B-box type zinc finger family protein (.1) AT3G21150 67 / 2e-14 CO EIP6, BBX32 EMF1-Interacting Protein 1, B-box domain protein 32, B-box 32 (.1) AT4G27310 65 / 9e-14 CO B-box type zinc finger family protein (.1) AT5G54470 63 / 6e-13 CO B-box type zinc finger family protein (.1) AT2G33500 58 / 8e-11 CO COL14 B-box type zinc finger protein with CCT domain (.1.2) AT1G28050 56 / 3e-10 CO COL15 B-box type zinc finger protein with CCT domain (.1) AT1G68190 55 / 1e-09 CO B-box zinc finger family protein (.1) AT2G24790 55 / 1e-09 CO COL3, ATCOL3 CONSTANS-like 3 (.1.2) AT5G15850 53 / 5e-09 CO COL1, ATCOL1 CONSTANS-like 1 (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.007G121100 [exp] 199 / 2e-67 AT4G15248 108 / 2e-31 B-box type zinc finger family protein (.1) Potri.004G027100 [exp] 65 / 2e-14 AT5G54470 97 / 4e-26 B-box type zinc finger family protein (.1) Potri.004G026900 [exp] 64 / 1e-13 AT4G27310 109 / 2e-30 B-box type zinc finger family protein (.1) Potri.013G150500 [exp] 64 / 2e-13 AT4G27310 114 / 1e-31 B-box type zinc finger family protein (.1) Potri.011G125400 [exp] 64 / 4e-13 AT5G54470 120 / 1e-32 B-box type zinc finger family protein (.1) Potri.011G039700 [exp] 62 / 8e-13 AT4G27310 105 / 3e-28 B-box type zinc finger family protein (.1) Potri.001G414700 [exp] 63 / 1e-12 AT5G54470 126 / 2e-35 B-box type zinc finger family protein (.1) Potri.008G007000 [exp] 62 / 2e-12 AT3G21150 128 / 3e-36 EMF1-Interacting Protein 1, B-box domain protein 32, B-box 32 (.1) Potri.017G039301 [exp] 60 / 2e-11 AT3G21880 288 / 2e-94 B-box type zinc finger protein with CCT domain (.1)
Flax homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10039694 [exp] 127 / 9e-39 AT4G15248 108 / 1e-31 B-box type zinc finger family protein (.1) Lus10027151 [exp] 125 / 4e-38 AT4G15248 109 / 7e-32 B-box type zinc finger family protein (.1) Lus10031583 [exp] 110 / 2e-32 AT3G21890 96 / 1e-26 B-box type zinc finger family protein (.1) Lus10015097 [exp] 108 / 2e-31 AT4G15248 94 / 5e-26 B-box type zinc finger family protein (.1) Lus10031593 [exp] 64 / 2e-13 AT4G27310 119 / 2e-33 B-box type zinc finger family protein (.1) Lus10033751 [exp] 64 / 4e-13 AT4G27310 114 / 9e-32 B-box type zinc finger family protein (.1) Lus10039727 [exp] 60 / 1e-11 AT5G54470 118 / 1e-32 B-box type zinc finger family protein (.1) Lus10018513 [exp] 60 / 1e-11 AT4G27310 117 / 3e-32 B-box type zinc finger family protein (.1) Lus10033380 [exp] 60 / 1e-11 AT3G21150 112 / 3e-30 EMF1-Interacting Protein 1, B-box domain protein 32, B-box 32 (.1) Lus10034830 [exp] 59 / 3e-11 AT3G21150 112 / 3e-30 EMF1-Interacting Protein 1, B-box domain protein 32, B-box 32 (.1)
PFAM info	Clan ID Clan name Pfam ID Pfam name Pfam description PF00643 [poplar] [flax] zf-B_box B-box zinc finger
Representative CDS sequence Show only first row Show all	>Potri.017G039400.1 pacid=42814126 polypeptide=Potri.017G039400.1.p locus=Potri.017G039400 ID=Potri.017G039400.1.v4.1 annot-version=v4.1 ATGTGTAGAGGTAATCAGGAGAGAAGTAACCAAGGCAGTTCTTGTAACAAGGAGGCTGTTTCACCTAATGCAACCTCAAGATTCGTTTGTTGTGAGCTAT GTGGCTCGAGGGCAACATTGTATTGTCAAGCAGATCATGCATTTCTATGTCAAAAATGTGACGGATGGGTGCATGGAGCTAATTTCTTAGCCCTCAGGCA TGTTAGAAACATGTTATGCAACACATGCCAAAATCTTACACAGAGATGTCTCATTGGGGCTTCAACTGAGGTGATGCTTTCAACTATTGTGAGTTGGAGA GAAAGAAGGGATCGTAATTCTAATCTTGAAAAGAAGTGCTCTGGATCACTTAAAAAGCCCTTTTCGTTTCTTTGA
AA sequence Show only first row Show all	>Potri.017G039400.1 pacid=42814126 polypeptide=Potri.017G039400.1.p locus=Potri.017G039400 ID=Potri.017G039400.1.v4.1 annot-version=v4.1 MCRGNQERSNQGSSCNKEAVSPNATSRFVCCELCGSRATLYCQADHAFLCQKCDGWVHGANFLALRHVRNMLCNTCQNLTQRCLIGASTEVMLSTIVSWR ERRDRNSNLEKKCSGSLKKPFSFL

---

DESeq2's median of ratios [POPLAR]

Mapped by: StringTie Salmon Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	NWA:WT	NWB:WT	NWA:OE-ARK2	NWB:OE-ARK2	NWA:miRNA-ARK2	NWB:miRNA-ARK2	NW 0hr	WT H20	WT-NW	TUA1dEY NW	TUA1dEY+TUB15 NW	TUA1dY+TUB9 NW	Pde NW	NWA:WT GA	NWBWT GA	TW:WT	TW:WT GA	NWA:OE-ARK2 GA	NWB:OE-ARK2 GA	TW:OE-ARK2	TW:OE-ARK2 GA	NWA:miRNA-ARK2 GA	NWB:miRNA-ARK2 GA	TW:miRNA-ARK2	TW:miRNA-ARK2 GA	TW 2hr	TW 8hr	TW 24hr	TW 48hr	TW 96hr	TW 336hr	WT ACC	35S::etr1-1 H20	35S::etr1-1 ACC	LMX5::etr1-1 H20	LMX5::etr1-1 ACC	WT-TW	TUA1dEY TW	TUA1dEY+TUB15 TW	TUA1dY+TUB9 TW	Pde TW	OW:WT	OW:WT GA	OW:OE-ARK2	OW:OE-ARK2 GA	OW:miRNA-ARK2	OW:miRNA-ARK2 GA	OW 2hr	OW 8hr	OW 24hr	OW 48hr	OW 96hr	OW 336hr	Root CTR	Root LongCold	Root LongDrougt	Root LongHeat	Root LongSalt	Root ShortCold	Root ShortDrougt	Root ShortHeat	Root ShortSalt	Ptr root	Leaf CTR	Leaf LongCold	Leaf LongDrougt	Leaf LongHeat	Leaf LongSalt	Leaf ShortCold	Leaf ShortDrougt	Leaf ShortHeat	Leaf ShortSalt	Ptr leaf	Stem CTR	Stem LongCold	Stem LongDrougt	Stem LongHeat	Stem LongSalt	Stem ShortCold	Stem ShortDrougt	Stem ShortHeat	Stem ShortSalt	Ptr shoot	Ptr xylem	Ptr phloem	Ptr fiber	Ptr vessel	Ptr fiber vessel ray
AT4G15248	CO		B-box type zinc finger family ...		Potri.017G039400 [exp]	0	1
AT5G44005			unknown protein		Potri.014G192100 [exp]	3.16	0.7827
AT2G45660	MADS	ATSOC1, SOC1, A...	SUPPRESSOR OF OVEREXPRESSION O...		Potri.002G151700 [exp]	10.24	0.7312
AT4G09320		NDPK1	Nucleoside diphosphate kinase ...		Potri.002G138800 [exp]	18.24	0.6818
AT1G65560			Zinc-binding dehydrogenase fam...		Potri.010G177700 [exp]	18.33	0.7361
AT2G41250			Haloacid dehalogenase-like hyd...		Potri.016G037600 [exp]	19.44	0.7326
AT1G14980		CPN10	chaperonin 10 (.1)		Potri.009G068900 [exp]	22.84	0.7258	CPN10.2
AT3G56490		HIT3, HINT1	HISTIDINE TRIAD NUCLEOTIDE-BIN...		Potri.016G023700 [exp]	25.92	0.6745
					Potri.017G119700 [exp]	27.22	0.7199
AT4G18020	GARP	APRR2	PSEUDO-RESPONSE REGULATOR 2, C...		Potri.001G146200 [exp]	35.66	0.6312	PtpRR11
AT1G01050		ATPPA1	pyrophosphorylase 1 (.1)		Potri.007G022700 [exp]	43.95	0.7217

Compare expression of checked genes

Potri.017G039400 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.