Plant FIBer expression Database

Potri.017G066388 [POPLAR]


External link
JGI Phytozome v13PopgenieAspWood                  
Symbol
Arabidopsis homologues
Locus ID BLAST score/e-value TF class Alias TAIR10 short description
AT5G14105 83 / 7e-23 unknown protein
Paralogs
Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description
Potri.001G328100
[exp]
89 / 3e-25 AT5G14105 75 / 1e-19 unknown protein
Flax homologues

No hit found
PFAM info
Representative CDS sequence
>Potri.017G066388.1 pacid=42814568 polypeptide=Potri.017G066388.1.p locus=Potri.017G066388 ID=Potri.017G066388.1.v4.1 annot-version=v4.1
ATGGGGTTGACAAACTTCATTATAACAGTAGCTGGTGTAAGTGCTGTGATTCTTTTACTAAGGAGCGATGTGAAGCAATCTGCTACTATCCTTAGACGCA
ACGTCAAGCATATCCGCCACTGGCTCGAAGAAGAAACTGCCGCCGCTTCCAAGGCTTCAAAAGAGGCATCACCTAAGGAACTGGAATCGAAGGTCCCTCG
AAAGGACATCCCCAAGGAGGACTAG
AA sequence
>Potri.017G066388.1 pacid=42814568 polypeptide=Potri.017G066388.1.p locus=Potri.017G066388 ID=Potri.017G066388.1.v4.1 annot-version=v4.1
MGLTNFIITVAGVSAVILLLRSDVKQSATILRRNVKHIRHWLEEETAAASKASKEASPKELESKVPRKDIPKED

DESeq2's median of ratios [POPLAR]

Mapped by: Order by: Show schematic diagram

Coexpressed genes

Only top 10 genes are shown Show allDownload tab-delimited text
Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.
At best At TF class At alias At description Locus MR r Symbol NWA:WTNWB:WTNWA:OE-ARK2NWB:OE-ARK2NWA:miRNA-ARK2NWB:miRNA-ARK2NW 0hrWT H20WT-NWTUA1dEY NWTUA1dEY+TUB15 NWTUA1dY+TUB9 NWPde NWNWA:WT GANWBWT GATW:WTTW:WT GANWA:OE-ARK2 GANWB:OE-ARK2 GATW:OE-ARK2TW:OE-ARK2 GANWA:miRNA-ARK2 GANWB:miRNA-ARK2 GATW:miRNA-ARK2TW:miRNA-ARK2 GATW 2hrTW 8hrTW 24hrTW 48hrTW 96hrTW 336hrWT ACC35S::etr1-1 H2035S::etr1-1 ACCLMX5::etr1-1 H20LMX5::etr1-1 ACCWT-TWTUA1dEY TWTUA1dEY+TUB15 TWTUA1dY+TUB9 TWPde TWOW:WTOW:WT GAOW:OE-ARK2OW:OE-ARK2 GAOW:miRNA-ARK2OW:miRNA-ARK2 GAOW 2hrOW 8hrOW 24hrOW 48hrOW 96hrOW 336hrRoot CTRRoot LongColdRoot LongDrougtRoot LongHeatRoot LongSaltRoot ShortColdRoot ShortDrougtRoot ShortHeatRoot ShortSaltPtr rootLeaf CTRLeaf LongColdLeaf LongDrougtLeaf LongHeatLeaf LongSaltLeaf ShortColdLeaf ShortDrougtLeaf ShortHeatLeaf ShortSaltPtr leafStem CTRStem LongColdStem LongDrougtStem LongHeatStem LongSaltStem ShortColdStem ShortDrougtStem ShortHeatStem ShortSaltPtr shootPtr xylemPtr phloemPtr fiberPtr vesselPtr fiber vessel ray
AT5G14105 unknown protein Potri.017G066388
[exp]
0 1
AT4G25315 Expressed protein (.1.2) Potri.004G189300
[exp]
1.73 0.8502
AT3G62920 unknown protein Potri.014G133600
[exp]
4.89 0.7723
AT4G14110 FUS7, EMB143, C... FUSCA 7, EMBRYO DEFECTIVE 143,... Potri.001G207900
[exp]
5.00 0.7698 EMB143.2
AT4G35490 MRPL11 mitochondrial ribosomal protei... Potri.007G058600
[exp]
5.09 0.8152
AT2G39500 unknown protein Potri.008G051100
[exp]
10.95 0.7326
AT4G17180 O-Glycosyl hydrolases family 1... Potri.006G002100
[exp]
13.49 0.7433
AT2G32060 Ribosomal protein L7Ae/L30e/S1... Potri.001G046600
[exp]
13.85 0.7616
AT1G10840 TIF3H1 translation initiation factor ... Potri.014G147100
[exp]
15.39 0.7879 TIF3.5
AT2G06010 ORG4 OBP3-responsive gene 4 (.1) Potri.018G065800
[exp]
17.23 0.7145 ORG4.2
AT4G26400 RING/U-box superfamily protein... Potri.017G038300
[exp]
18.97 0.7405

Potri.017G066388 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.