Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser] Popgenie AspWood
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT1G64750 50 / 6e-10 DSS1(I), ATDSS1(I), DSS1(I), ATDSS1(I), DSS1(I), ATDSS1(I), DSS1(I), ATDSS1(I), DSS1(I), ATDSS1(I), deletion of SUV3 suppressor 1(I) (.1), deletion of SUV3 suppressor 1(I) (.2), deletion of SUV3 suppressor 1(I) (.3) AT5G45010 49 / 2e-09 DSS1(V), ATDSS1(V), DSS1(V), ATDSS1(V), DSS1(V), ATDSS1(V), DSS1(V), ATDSS1(V), DSS1(V), ATDSS1(V), DSS1 homolog on chromosome V (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.001G334600 [exp] 50 / 1e-09 AT1G64750 / deletion of SUV3 suppressor 1(I) (.1), deletion of SUV3 suppressor 1(I) (.2), deletion of SUV3 suppressor 1(I) (.3)
Flax homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10013049 [exp] 63 / 8e-15 AT1G64750 49 / 1e-09 deletion of SUV3 suppressor 1(I) (.1), deletion of SUV3 suppressor 1(I) (.2), deletion of SUV3 suppressor 1(I) (.3) Lus10030906 [exp] 60 / 1e-13 AT1G64750 47 / 1e-08 deletion of SUV3 suppressor 1(I) (.1), deletion of SUV3 suppressor 1(I) (.2), deletion of SUV3 suppressor 1(I) (.3) Lus10030583 [exp] 60 / 1e-13 AT1G64750 47 / 9e-09 deletion of SUV3 suppressor 1(I) (.1), deletion of SUV3 suppressor 1(I) (.2), deletion of SUV3 suppressor 1(I) (.3) Lus10029113 [exp] 57 / 3e-11 AT1G68940 572 / 0.0 Armadillo/beta-catenin-like repeat family protein (.1.2.3)
PFAM info	Clan ID Clan name Pfam ID Pfam name Pfam description PF05160 [poplar] [flax] DSS1_SEM1 DSS1/SEM1 family
Representative CDS sequence Show only first row Show all	>Potri.017G066900.2 pacid=42814020 polypeptide=Potri.017G066900.2.p locus=Potri.017G066900 ID=Potri.017G066900.2.v4.1 annot-version=v4.1 ATGGCAACTGAAACGAAACCAGCAACTGAGGATGTGAAGATTGACTTGTTCGAGGACGACGATGAATTTGAAGAATTTGAAATCAATGGAGAGTGGGAAG TGAAGGAGGAAGGGAAAGACGCGACACAGCAGTGGGAGGATGATTGGGATGATGATGATGTCAATGACGACTTCTCACTGCAGCTAAGGAAGGAATTGGA GAACAATACACAGAAGAACTGA
AA sequence Show only first row Show all	>Potri.017G066900.2 pacid=42814020 polypeptide=Potri.017G066900.2.p locus=Potri.017G066900 ID=Potri.017G066900.2.v4.1 annot-version=v4.1 MATETKPATEDVKIDLFEDDDEFEEFEINGEWEVKEEGKDATQQWEDDWDDDDVNDDFSLQLRKELENNTQKN

---

DESeq2's median of ratios [POPLAR]

Mapped by: StringTie Salmon Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	NWA:WT	NWB:WT	NWA:OE-ARK2	NWB:OE-ARK2	NWA:miRNA-ARK2	NWB:miRNA-ARK2	NW 0hr	WT H20	WT-NW	TUA1dEY NW	TUA1dEY+TUB15 NW	TUA1dY+TUB9 NW	Pde NW	NWA:WT GA	NWBWT GA	TW:WT	TW:WT GA	NWA:OE-ARK2 GA	NWB:OE-ARK2 GA	TW:OE-ARK2	TW:OE-ARK2 GA	NWA:miRNA-ARK2 GA	NWB:miRNA-ARK2 GA	TW:miRNA-ARK2	TW:miRNA-ARK2 GA	TW 2hr	TW 8hr	TW 24hr	TW 48hr	TW 96hr	TW 336hr	WT ACC	35S::etr1-1 H20	35S::etr1-1 ACC	LMX5::etr1-1 H20	LMX5::etr1-1 ACC	WT-TW	TUA1dEY TW	TUA1dEY+TUB15 TW	TUA1dY+TUB9 TW	Pde TW	OW:WT	OW:WT GA	OW:OE-ARK2	OW:OE-ARK2 GA	OW:miRNA-ARK2	OW:miRNA-ARK2 GA	OW 2hr	OW 8hr	OW 24hr	OW 48hr	OW 96hr	OW 336hr	Root CTR	Root LongCold	Root LongDrougt	Root LongHeat	Root LongSalt	Root ShortCold	Root ShortDrougt	Root ShortHeat	Root ShortSalt	Ptr root	Leaf CTR	Leaf LongCold	Leaf LongDrougt	Leaf LongHeat	Leaf LongSalt	Leaf ShortCold	Leaf ShortDrougt	Leaf ShortHeat	Leaf ShortSalt	Ptr leaf	Stem CTR	Stem LongCold	Stem LongDrougt	Stem LongHeat	Stem LongSalt	Stem ShortCold	Stem ShortDrougt	Stem ShortHeat	Stem ShortSalt	Ptr shoot	Ptr xylem	Ptr phloem	Ptr fiber	Ptr vessel	Ptr fiber vessel ray
AT1G64750		DSS1(I), ATDSS1...	deletion of SUV3 suppressor 1(...		Potri.017G066900 [exp]	0	1
AT3G05010			Protein of unknown function, t...		Potri.013G031200 [exp]	2.00	0.7617
AT5G20700			Protein of unknown function (D...		Potri.006G078300 [exp]	4.00	0.7956
AT3G26922			F-box/RNI-like superfamily pro...		Potri.011G104200 [exp]	7.07	0.7257
AT1G72330		ALAAT2	alanine aminotransferase 2 (.1...		Potri.003G072600 [exp]	9.89	0.7143
AT3G19553			Amino acid permease family pro...		Potri.009G090300 [exp]	10.00	0.6759	PtrLAT7
AT4G14455		ATBS14B ,ATBET1...	ARABIDOPSIS THALIANA BET1P/SFT...		Potri.010G074100 [exp]	22.22	0.6989
AT1G09794			Cox19 family protein (CHCH mot...		Potri.003G009800 [exp]	22.97	0.7071
AT3G07568			unknown protein		Potri.014G197400 [exp]	22.97	0.6666
AT1G15270			Translation machinery associat...		Potri.001G181800 [exp]	27.71	0.7213
AT1G62350			Pentatricopeptide repeat (PPR)...		Potri.001G275000 [exp]	36.05	0.6506

Compare expression of checked genes

Potri.017G066900 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.