Potri.017G095700 [POPLAR]


External link
JGI Phytozome v13PopgenieAspWood                  
Symbol
Arabidopsis homologues
Locus ID BLAST score/e-value TF class Alias TAIR10 short description
AT3G29780 47 / 1e-07 RALFL27 ralf-like 27 (.1)
Paralogs
Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description
Potri.017G096300 201 / 2e-68 AT3G29780 46 / 2e-07 ralf-like 27 (.1)
Potri.017G098100 199 / 1e-67 AT3G29780 46 / 2e-07 ralf-like 27 (.1)
Potri.017G096500 165 / 2e-54 AT3G29780 50 / 5e-09 ralf-like 27 (.1)
Potri.017G098300 92 / 5e-26 AT3G29780 50 / 9e-10 ralf-like 27 (.1)
Flax homologues

No hit found

PFAM info
Clan ID Clan name Pfam ID Pfam name Pfam description
PF05498 RALF Rapid ALkalinization Factor (RALF)
Representative CDS sequence
>Potri.017G095700.2 pacid=42814359 polypeptide=Potri.017G095700.2.p locus=Potri.017G095700 ID=Potri.017G095700.2.v4.1 annot-version=v4.1
ATGAGGCCTAACGTAAGTATTGAATTCCTCTGGTGGCTCTCTTTAACTATCCTGCTGGTTTCTGTGATCACATCTACTTCTACAGCTGCCTTTCTTGAAA
GCAACTCGAGCCCCATTTTCAATGCCACAATCGGTGAAGGTAATGAAGAGGAGTTCTCTATGGAATCTGAAGTGCATCAGAGACTGCTGGCCTATCCGGG
TAATCATATTAACTATAAGACTTTAGAACGACAACAAGTTTGCAATGCACAAATGTATGGCAGCTGTGTAAAACCGATCAATCGTGACTCTCGGCCTTGC
ACTTACTACAATCGGTGCAAACGTGGTAGTTGA
AA sequence
>Potri.017G095700.2 pacid=42814359 polypeptide=Potri.017G095700.2.p locus=Potri.017G095700 ID=Potri.017G095700.2.v4.1 annot-version=v4.1
MRPNVSIEFLWWLSLTILLVSVITSTSTAAFLESNSSPIFNATIGEGNEEEFSMESEVHQRLLAYPGNHINYKTLERQQVCNAQMYGSCVKPINRDSRPC
TYYNRCKRGS

DESeq2's median of ratios [POPLAR]

Mapped by: Order by: Show schematic diagram

Coexpressed genes

Only top 10 genes are shown Show allDownload tab-delimited text
Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.
At best At TF class At alias At description Locus MR r Symbol NWA:WTNWB:WTNWA:OE-ARK2NWB:OE-ARK2NWA:miRNA-ARK2NWB:miRNA-ARK2NW 0hrWT H20WT-NWTUA1dEY NWTUA1dEY+TUB15 NWTUA1dY+TUB9 NWPde NWNWA:WT GANWBWT GATW:WTTW:WT GANWA:OE-ARK2 GANWB:OE-ARK2 GATW:OE-ARK2TW:OE-ARK2 GANWA:miRNA-ARK2 GANWB:miRNA-ARK2 GATW:miRNA-ARK2TW:miRNA-ARK2 GATW 2hrTW 8hrTW 24hrTW 48hrTW 96hrTW 336hrWT ACC35S::etr1-1 H2035S::etr1-1 ACCLMX5::etr1-1 H20LMX5::etr1-1 ACCWT-TWTUA1dEY TWTUA1dEY+TUB15 TWTUA1dY+TUB9 TWPde TWOW:WTOW:WT GAOW:OE-ARK2OW:OE-ARK2 GAOW:miRNA-ARK2OW:miRNA-ARK2 GAOW 2hrOW 8hrOW 24hrOW 48hrOW 96hrOW 336hrRoot CTRRoot LongColdRoot LongDrougtRoot LongHeatRoot LongSaltRoot ShortColdRoot ShortDrougtRoot ShortHeatRoot ShortSaltPtr rootLeaf CTRLeaf LongColdLeaf LongDrougtLeaf LongHeatLeaf LongSaltLeaf ShortColdLeaf ShortDrougtLeaf ShortHeatLeaf ShortSaltPtr leafStem CTRStem LongColdStem LongDrougtStem LongHeatStem LongSaltStem ShortColdStem ShortDrougtStem ShortHeatStem ShortSaltPtr shootPtr xylemPtr phloemPtr fiberPtr vesselPtr fiber vessel ray
AT3G29780 RALFL27 ralf-like 27 (.1) Potri.017G095700 0 1
AT3G29780 RALFL27 ralf-like 27 (.1) Potri.017G096300 1.00 0.9996
AT3G29780 RALFL27 ralf-like 27 (.1) Potri.017G098100 2.00 0.9968
AT1G55020 ATLOX1, LOX1 ARABIDOPSIS LIPOXYGENASE 1, li... Potri.013G022100 3.60 0.9332
AT4G09460 MYB ATMYB6, ATMYB8 myb domain protein 6 (.1) Potri.004G088100 3.87 0.9417
AT4G25640 FFT, ATDTX35 FLOWER FLAVONOID TRANSPORTER, ... Potri.012G144900 10.39 0.9335
AT5G17540 HXXXD-type acyl-transferase fa... Potri.019G043600 12.00 0.9292
Potri.006G132951 13.85 0.9238
AT5G54270 LHCB3*1, LHCB3*... light-harvesting chlorophyll B... Potri.001G407100 16.49 0.9376 Lhcb3-1,LHCB3.2
AT4G30580 LPAT1, ATS2, EM... lysophosphatidic acid acyltran... Potri.011G138900 18.38 0.9204
AT3G46780 PTAC16 plastid transcriptionally acti... Potri.009G037000 18.97 0.9348

Potri.017G095700 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.