Potri.017G111225 [POPLAR]


External link
JGI Phytozome v13PopgenieAspWood                  
Symbol
Arabidopsis homologues

No hit found

Paralogs
Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description
Potri.017G111000 93 / 4e-27 ND /
Potri.017G110900 76 / 2e-20 ND /
Potri.017G111100 72 / 1e-18 ND /
Potri.017G111150 69 / 2e-17 ND /
Potri.017G110800 48 / 5e-09 ND /
Potri.T124904 47 / 2e-08 ND /
Potri.009G111938 43 / 4e-07 ND /
Potri.T124804 39 / 1e-05 ND /
Potri.009G111815 39 / 2e-05 ND /
Flax homologues

No hit found

PFAM info
Representative CDS sequence
>Potri.017G111225.1 pacid=42813253 polypeptide=Potri.017G111225.1.p locus=Potri.017G111225 ID=Potri.017G111225.1.v4.1 annot-version=v4.1
ATGAAGGCCTTTCTTATCGCATGCATTCTCTTGGCTACCATTGTCTTCTCTCCCTTATCCACTTGCACTGCTCGAGAATTGGCCGAGCGAGACGCATCCC
GAGGAGCTGTTGACCCCGGCAAAGTCCCAACTTACCCCAGTGACCCCTTTCCACCAGTGTACGGTTGCCCAAATCCTTACAAGCGTAATTGTGGGCGCCA
TTAA
AA sequence
>Potri.017G111225.1 pacid=42813253 polypeptide=Potri.017G111225.1.p locus=Potri.017G111225 ID=Potri.017G111225.1.v4.1 annot-version=v4.1
MKAFLIACILLATIVFSPLSTCTARELAERDASRGAVDPGKVPTYPSDPFPPVYGCPNPYKRNCGRH

DESeq2's median of ratios [POPLAR]

Mapped by: Order by: Show schematic diagram

Coexpressed genes

Only top 10 genes are shown Show allDownload tab-delimited text
Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.
At best At TF class At alias At description Locus MR r Symbol NWA:WTNWB:WTNWA:OE-ARK2NWB:OE-ARK2NWA:miRNA-ARK2NWB:miRNA-ARK2NW 0hrWT H20WT-NWTUA1dEY NWTUA1dEY+TUB15 NWTUA1dY+TUB9 NWPde NWNWA:WT GANWBWT GATW:WTTW:WT GANWA:OE-ARK2 GANWB:OE-ARK2 GATW:OE-ARK2TW:OE-ARK2 GANWA:miRNA-ARK2 GANWB:miRNA-ARK2 GATW:miRNA-ARK2TW:miRNA-ARK2 GATW 2hrTW 8hrTW 24hrTW 48hrTW 96hrTW 336hrWT ACC35S::etr1-1 H2035S::etr1-1 ACCLMX5::etr1-1 H20LMX5::etr1-1 ACCWT-TWTUA1dEY TWTUA1dEY+TUB15 TWTUA1dY+TUB9 TWPde TWOW:WTOW:WT GAOW:OE-ARK2OW:OE-ARK2 GAOW:miRNA-ARK2OW:miRNA-ARK2 GAOW 2hrOW 8hrOW 24hrOW 48hrOW 96hrOW 336hrRoot CTRRoot LongColdRoot LongDrougtRoot LongHeatRoot LongSaltRoot ShortColdRoot ShortDrougtRoot ShortHeatRoot ShortSaltPtr rootLeaf CTRLeaf LongColdLeaf LongDrougtLeaf LongHeatLeaf LongSaltLeaf ShortColdLeaf ShortDrougtLeaf ShortHeatLeaf ShortSaltPtr leafStem CTRStem LongColdStem LongDrougtStem LongHeatStem LongSaltStem ShortColdStem ShortDrougtStem ShortHeatStem ShortSaltPtr shootPtr xylemPtr phloemPtr fiberPtr vesselPtr fiber vessel ray
Potri.017G111225 0 1
AT2G02450 NAC LOV1, ANAC034, ... LONG VEGETATIVE PHASE 1, Arabi... Potri.003G046700 1.00 0.9809
AT1G15460 ATBOR4 ARABIDOPSIS THALIANA REQUIRES ... Potri.003G059700 2.00 0.9699
AT5G54770 THI4, TZ, THI1 THIAZOLE REQUIRING, THIAMINE4,... Potri.004G020500 4.47 0.9543
AT5G23250 Succinyl-CoA ligase, alpha sub... Potri.016G071850 4.89 0.9511
AT5G41410 HD BEL1 BELL 1, POX (plant homeobox) f... Potri.003G131300 5.19 0.9607
AT5G07580 AP2_ERF Integrase-type DNA-binding sup... Potri.003G151000 5.65 0.9417
Potri.001G093100 5.74 0.9466
AT2G37220 RNA-binding (RRM/RBD/RNP motif... Potri.006G127200 7.74 0.9576 RBP29.2
AT2G16890 UDP-Glycosyltransferase superf... Potri.001G348100 8.36 0.9509
Potri.017G110900 8.48 0.9394

Potri.017G111225 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.