Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser] Popgenie AspWood
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT5G37670 160 / 1e-51 HSP15.7CI HSP20-like chaperones superfamily protein (.1) AT1G59860 102 / 2e-28 HSP20-like chaperones superfamily protein (.1) AT1G07400 97 / 2e-26 HSP20-like chaperones superfamily protein (.1) AT1G53540 97 / 3e-26 HSP20-like chaperones superfamily protein (.1) AT3G46230 82 / 2e-20 ATHSP17.4 ARABIDOPSIS THALIANA HEAT SHOCK PROTEIN 17.4, heat shock protein 17.4 (.1) AT2G29500 81 / 5e-20 HSP20-like chaperones superfamily protein (.1) AT5G59720 80 / 2e-19 HSP18.2 HSP18.1CI heat shock protein 18.2 (.1) AT4G10250 66 / 4e-14 ATHSP22.0 HSP20-like chaperones superfamily protein (.1) AT4G21870 54 / 4e-10 HSP20-like chaperones superfamily protein (.1) AT1G52560 54 / 2e-09 HSP20-like chaperones superfamily protein (.1.2)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.009G039200 [exp] 96 / 4e-26 AT1G07400 201 / 3e-67 HSP20-like chaperones superfamily protein (.1) Potri.010G175200 [exp] 94 / 3e-25 AT1G53540 107 / 5e-30 HSP20-like chaperones superfamily protein (.1) Potri.009G148000 [exp] 91 / 7e-24 AT2G29500 190 / 7e-63 HSP20-like chaperones superfamily protein (.1) Potri.009G049900 [exp] 89 / 2e-23 AT2G29500 154 / 2e-48 HSP20-like chaperones superfamily protein (.1) Potri.019G081250 [exp] 88 / 6e-23 AT2G29500 182 / 6e-60 HSP20-like chaperones superfamily protein (.1) Potri.009G049800 [exp] 88 / 6e-23 AT2G29500 152 / 4e-48 HSP20-like chaperones superfamily protein (.1) Potri.004G187450 [exp] 87 / 2e-22 AT2G29500 221 / 5e-75 HSP20-like chaperones superfamily protein (.1) Potri.004G187400 [exp] 87 / 2e-22 AT1G07400 193 / 7e-64 HSP20-like chaperones superfamily protein (.1) Potri.009G147900 [exp] 86 / 4e-22 AT2G29500 193 / 5e-64 HSP20-like chaperones superfamily protein (.1)
Flax homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10020815 [exp] 193 / 2e-64 AT5G37670 166 / 6e-54 HSP20-like chaperones superfamily protein (.1) Lus10004039 [exp] 153 / 6e-49 AT5G37670 150 / 3e-48 HSP20-like chaperones superfamily protein (.1) Lus10042408 [exp] 85 / 4e-21 AT4G10250 154 / 1e-47 HSP20-like chaperones superfamily protein (.1) Lus10009085 [exp] 83 / 7e-21 AT1G53540 232 / 2e-79 HSP20-like chaperones superfamily protein (.1) Lus10026262 [exp] 79 / 4e-19 AT4G10250 152 / 5e-47 HSP20-like chaperones superfamily protein (.1) Lus10040723 [exp] 72 / 9e-17 AT2G29500 219 / 3e-74 HSP20-like chaperones superfamily protein (.1) Lus10040722 [exp] 72 / 1e-16 AT1G07400 214 / 2e-72 HSP20-like chaperones superfamily protein (.1) Lus10016458 [exp] 71 / 6e-16 AT2G29500 214 / 3e-72 HSP20-like chaperones superfamily protein (.1) Lus10016457 [exp] 71 / 6e-16 AT1G07400 216 / 4e-73 HSP20-like chaperones superfamily protein (.1) Lus10016456 [exp] 71 / 7e-16 AT1G07400 213 / 8e-72 HSP20-like chaperones superfamily protein (.1)
PFAM info	Clan ID Clan name Pfam ID Pfam name Pfam description CL0190 [poplar] [flax] HSP20 PF00011 [poplar] [flax] HSP20 Hsp20/alpha crystallin family
Representative CDS sequence Show only first row Show all	>Potri.017G130700.2 pacid=42813491 polypeptide=Potri.017G130700.2.p locus=Potri.017G130700 ID=Potri.017G130700.2.v4.1 annot-version=v4.1 ATGGCTGATGGCTTCTTTGGGTACCCTTTTAGGCGCTTGTTCTTGAGCCCTCCAGCATACCATGAATGGTCTGGATCAACTGCTCTCATGGACTGGCTTG AATCCCCAACTGCCCATATTTTTAAAGTCAATGTACCAGGGTTTAACAAAGAGGACATAAAGGTTCAAGTGGGAGATGGGAATATTTTGCACATAAAAGG TGAGGGTGGCAAAGAGGAAACCCATGAGAAAGACACAGTTTGGCATGTAGCTGAGAGAGGGACAAGAAAGAGGGGCTTTTCTAGAGAAATTGAGCTACCA GAAGACGTGAAGCTGGATCAAATCAAAGCTCAAGTTGAAAATGGTGTTCTCACCATTGTTGCTCCAAAGGATACCAATCCAAAGCAATCTAAAGTTAGGA ACATCAATATCACTAGCAAGCTTTGA
AA sequence Show only first row Show all	>Potri.017G130700.2 pacid=42813491 polypeptide=Potri.017G130700.2.p locus=Potri.017G130700 ID=Potri.017G130700.2.v4.1 annot-version=v4.1 MADGFFGYPFRRLFLSPPAYHEWSGSTALMDWLESPTAHIFKVNVPGFNKEDIKVQVGDGNILHIKGEGGKEETHEKDTVWHVAERGTRKRGFSREIELP EDVKLDQIKAQVENGVLTIVAPKDTNPKQSKVRNINITSKL

---

DESeq2's median of ratios [POPLAR]

Mapped by: StringTie Salmon Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	NWA:WT	NWB:WT	NWA:OE-ARK2	NWB:OE-ARK2	NWA:miRNA-ARK2	NWB:miRNA-ARK2	NW 0hr	WT H20	WT-NW	TUA1dEY NW	TUA1dEY+TUB15 NW	TUA1dY+TUB9 NW	Pde NW	NWA:WT GA	NWBWT GA	TW:WT	TW:WT GA	NWA:OE-ARK2 GA	NWB:OE-ARK2 GA	TW:OE-ARK2	TW:OE-ARK2 GA	NWA:miRNA-ARK2 GA	NWB:miRNA-ARK2 GA	TW:miRNA-ARK2	TW:miRNA-ARK2 GA	TW 2hr	TW 8hr	TW 24hr	TW 48hr	TW 96hr	TW 336hr	WT ACC	35S::etr1-1 H20	35S::etr1-1 ACC	LMX5::etr1-1 H20	LMX5::etr1-1 ACC	WT-TW	TUA1dEY TW	TUA1dEY+TUB15 TW	TUA1dY+TUB9 TW	Pde TW	OW:WT	OW:WT GA	OW:OE-ARK2	OW:OE-ARK2 GA	OW:miRNA-ARK2	OW:miRNA-ARK2 GA	OW 2hr	OW 8hr	OW 24hr	OW 48hr	OW 96hr	OW 336hr	Root CTR	Root LongCold	Root LongDrougt	Root LongHeat	Root LongSalt	Root ShortCold	Root ShortDrougt	Root ShortHeat	Root ShortSalt	Ptr root	Leaf CTR	Leaf LongCold	Leaf LongDrougt	Leaf LongHeat	Leaf LongSalt	Leaf ShortCold	Leaf ShortDrougt	Leaf ShortHeat	Leaf ShortSalt	Ptr leaf	Stem CTR	Stem LongCold	Stem LongDrougt	Stem LongHeat	Stem LongSalt	Stem ShortCold	Stem ShortDrougt	Stem ShortHeat	Stem ShortSalt	Ptr shoot	Ptr xylem	Ptr phloem	Ptr fiber	Ptr vessel	Ptr fiber vessel ray
AT5G37670		HSP15.7CI	HSP20-like chaperones superfam...		Potri.017G130700 [exp]	0	1
AT2G32120		HSP70T-2	heat-shock protein 70T-2 (.1.2...		Potri.010G088600 [exp]	2.23	0.9891
AT3G07090			PPPDE putative thiol peptidase...		Potri.002G241700 [exp]	2.44	0.9870
AT3G08970		TMS1, ATERDJ3A	THERMOSENSITIVE MALE STERILE 1...		Potri.016G120000 [exp]	2.44	0.9856
AT2G20560			DNAJ heat shock family protein...		Potri.011G057601 [exp]	3.16	0.9832
AT3G09350		Fes1A	Fes1A (.1.2.3)		Potri.006G088000 [exp]	5.19	0.9811
AT4G22740			glycine-rich protein (.1.2)		Potri.003G115400 [exp]	5.47	0.9811
AT4G25200		ATHSP23.6-MITO	mitochondrion-localized small ...		Potri.003G076000 [exp]	5.65	0.9847
AT5G22480			ZPR1 zinc-finger domain protei...		Potri.004G075600 [exp]	6.00	0.9494
AT2G45380			unknown protein		Potri.014G069100 [exp]	6.70	0.9762
					Potri.004G234150 [exp]	6.92	0.9616

Compare expression of checked genes

Potri.017G130700 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.