Plant FIBer expression Database

Potri.018G060100 [POPLAR]


External link
JGI Phytozome v13PopgenieAspWood                  
Symbol
Arabidopsis homologues

No hit found

Paralogs
Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description
Potri.001G473250
[exp]
173 / 1e-57 ND /
Potri.006G126750
[exp]
161 / 9e-53 ND /
Flax homologues

No hit found
PFAM info
Representative CDS sequence
>Potri.018G060100.1 pacid=42800425 polypeptide=Potri.018G060100.1.p locus=Potri.018G060100 ID=Potri.018G060100.1.v4.1 annot-version=v4.1
ATGATGAAAGTAAAAGTGAATACAATATCAGGTTCAATAGACTTGATTGAAAGCTCTAGAAGAGCTAATATAACGCTTCCTAATAGAACAAGATTTATTA
TTAATAATGCTTTGTTCTCTACTAAATCAAGGAGAAATCTACTAAGTTTCAAAGATATACGACTTCACGGGTACCATATTGAGATTGCTAATGACAATGA
TATAGAATATCTTTACATCTTATCAAATGTCTCTACTGAAAAACAAATATTGAAAAAATTACTCGTTTTATCTTCAGGTTTGCACTACACAAGTATTAGT
ACAATCGAAGTCAATGCAATAATGAATTAG
AA sequence
>Potri.018G060100.1 pacid=42800425 polypeptide=Potri.018G060100.1.p locus=Potri.018G060100 ID=Potri.018G060100.1.v4.1 annot-version=v4.1
MMKVKVNTISGSIDLIESSRRANITLPNRTRFIINNALFSTKSRRNLLSFKDIRLHGYHIEIANDNDIEYLYILSNVSTEKQILKKLLVLSSGLHYTSIS
TIEVNAIMN

DESeq2's median of ratios [POPLAR]

Mapped by: Order by: Show schematic diagram

Coexpressed genes

Only top 10 genes are shown Show allDownload tab-delimited text
Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.
At best At TF class At alias At description Locus MR r Symbol NWA:WTNWB:WTNWA:OE-ARK2NWB:OE-ARK2NWA:miRNA-ARK2NWB:miRNA-ARK2NW 0hrWT H20WT-NWTUA1dEY NWTUA1dEY+TUB15 NWTUA1dY+TUB9 NWPde NWNWA:WT GANWBWT GATW:WTTW:WT GANWA:OE-ARK2 GANWB:OE-ARK2 GATW:OE-ARK2TW:OE-ARK2 GANWA:miRNA-ARK2 GANWB:miRNA-ARK2 GATW:miRNA-ARK2TW:miRNA-ARK2 GATW 2hrTW 8hrTW 24hrTW 48hrTW 96hrTW 336hrWT ACC35S::etr1-1 H2035S::etr1-1 ACCLMX5::etr1-1 H20LMX5::etr1-1 ACCWT-TWTUA1dEY TWTUA1dEY+TUB15 TWTUA1dY+TUB9 TWPde TWOW:WTOW:WT GAOW:OE-ARK2OW:OE-ARK2 GAOW:miRNA-ARK2OW:miRNA-ARK2 GAOW 2hrOW 8hrOW 24hrOW 48hrOW 96hrOW 336hrRoot CTRRoot LongColdRoot LongDrougtRoot LongHeatRoot LongSaltRoot ShortColdRoot ShortDrougtRoot ShortHeatRoot ShortSaltPtr rootLeaf CTRLeaf LongColdLeaf LongDrougtLeaf LongHeatLeaf LongSaltLeaf ShortColdLeaf ShortDrougtLeaf ShortHeatLeaf ShortSaltPtr leafStem CTRStem LongColdStem LongDrougtStem LongHeatStem LongSaltStem ShortColdStem ShortDrougtStem ShortHeatStem ShortSaltPtr shootPtr xylemPtr phloemPtr fiberPtr vesselPtr fiber vessel ray
Potri.018G060100
[exp]
0 1
AT1G32700 PLATZ transcription factor fam... Potri.005G130300
[exp]
1.00 1.0000
AT2G01260 Protein of unknown function (D... Potri.019G119100
[exp]
5.83 0.8881
AT5G53040 GRD, RKD4 RWP-RK domain-containing 4, GR... Potri.015G011800
[exp]
8.36 0.9146
AT2G37030 SAUR-like auxin-responsive pro... Potri.008G037900
[exp]
10.24 0.8941 SAUR40
AT4G27590 Heavy metal transport/detoxifi... Potri.012G007200
[exp]
11.83 0.8448
Potri.001G459001
[exp]
14.69 0.9117
AT5G64260 EXL2, MSJ1.10 EXORDIUM like 2 (.1) Potri.014G126000
[exp]
15.49 0.8137
AT5G40780 LHT1, LTH1 lysine histidine transporter 1... Potri.010G055800
[exp]
21.54 0.8362
AT1G37140 MCT1 MEI2 C-terminal RRM only like ... Potri.002G088200
[exp]
22.44 0.8862
AT3G18010 HD WOX1 WUSCHEL related homeobox 1 (.1... Potri.010G111400
[exp]
22.62 0.8897

Potri.018G060100 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.